Molecule Information
General Information of the Molecule (ID: Mol01592)
Name |
hsa-miR-15b-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 15b
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UAGCAGCACAUCAUGGUUUACA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colon cancer | [1] | |||
Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
NF-kappaB signaling pathway | Inhibition | hsa04064 | ||
In Vitro Model | DLD1 cells | Colon | Homo sapiens (Human) | CVCL_0248 |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
NCM460 cells | Colon | Homo sapiens (Human) | CVCL_0460 | |
SW1116 cells | Colon | Homo sapiens (Human) | CVCL_0544 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CellTiter-Glo Luminescent Cell Viability Assay; CCK8 assay; Flow cytometric analysis | |||
Mechanism Description | miR15b-5p resensitizes colon cancer cells to 5-fluorouracil by promoting apoptosis via the NF-kB/XIAP axis. miR15b-5p results in significant reductions in the levels of NF-kB1 and Ikk-alpha, two key modulators in inflammation and cell apoptosis. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.