General Information of the Molecule (ID: Mol01592)
Name
hsa-miR-15b-5p ,Homo sapiens
Synonyms
microRNA 15b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAGCAGCACAUCAUGGUUUACA
    Click to Show/Hide
Ensembl ID
ENSG00000207779
HGNC ID
HGNC:31544
Mature Accession
MIMAT0000417
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
NF-kappaB signaling pathway Inhibition hsa04064
In Vitro Model DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
NCM460 cells Colon Homo sapiens (Human) CVCL_0460
SW1116 cells Colon Homo sapiens (Human) CVCL_0544
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CellTiter-Glo Luminescent Cell Viability Assay; CCK8 assay; Flow cytometric analysis
Mechanism Description miR15b-5p resensitizes colon cancer cells to 5-fluorouracil by promoting apoptosis via the NF-kB/XIAP axis. miR15b-5p results in significant reductions in the levels of NF-kB1 and Ikk-alpha, two key modulators in inflammation and cell apoptosis.
References
Ref 1 miR-15b-5p resensitizes colon cancer cells to 5-fluorouracil by promoting apoptosis via the NF-kB/XIAP axis. Sci Rep. 2017 Jun 23;7(1):4194. doi: 10.1038/s41598-017-04172-z.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.