Molecule Information
General Information of the Molecule (ID: Mol01592)
| Name |
hsa-miR-15b-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 15b
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UAGCAGCACAUCAUGGUUUACA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [1] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| NF-kappaB signaling pathway | Inhibition | hsa04064 | ||
| In Vitro Model | DLD1 cells | Colon | Homo sapiens (Human) | CVCL_0248 |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| NCM460 cells | Colon | Homo sapiens (Human) | CVCL_0460 | |
| SW1116 cells | Colon | Homo sapiens (Human) | CVCL_0544 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo Luminescent Cell Viability Assay; CCK8 assay; Flow cytometric analysis | |||
| Mechanism Description | miR15b-5p resensitizes colon cancer cells to 5-fluorouracil by promoting apoptosis via the NF-kB/XIAP axis. miR15b-5p results in significant reductions in the levels of NF-kB1 and Ikk-alpha, two key modulators in inflammation and cell apoptosis. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
