Molecule Information

General Information of the Molecule (ID: Mol01592)

• Name: hsa-miR-15b-5p ,Homo sapiens
• Synonyms: microRNA 15b
• Molecule Type: Mature miRNA
• Sequence: UAGCAGCACAUCAUGGUUUACA
• Ensembl ID: ENSG00000207779
• HGNC ID: HGNC:31544
• Mature Accession: MIMAT0000417

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: NCM460 cells; Colon; Homo sapiens (Human); CVCL_0460
• In Vitro Model: SW1116 cells; Colon; Homo sapiens (Human); CVCL_0544
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter-Glo Luminescent Cell Viability Assay; CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR15b-5p resensitizes colon cancer cells to 5-fluorouracil by promoting apoptosis via the NF-kB/XIAP axis. miR15b-5p results in significant reductions in the levels of NF-kB1 and Ikk-alpha, two key modulators in inflammation and cell apoptosis.

References

• Ref 1: miR-15b-5p resensitizes colon cancer cells to 5-fluorouracil by promoting apoptosis via the NF-kB/XIAP axis. Sci Rep. 2017 Jun 23;7(1):4194. doi: 10.1038/s41598-017-04172-z.