General Information of the Molecule (ID: Mol01590)
Name
hsa-miR-223-3p ,Homo sapiens
Synonyms
microRNA 223
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGUCAGUUUGUCAAAUACCCCA
    Click to Show/Hide
Ensembl ID
ENSG00000284567
HGNC ID
HGNC:31603
Mature Accession
MIMAT0000280
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [1]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
LNCaP cells Prostate Homo sapiens (Human) CVCL_0395
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
C4-2 cells Prostate Homo sapiens (Human) CVCL_4782
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; TUNEL assay; Flow cytometry assay
Mechanism Description miR-223-3p inhibitor sensitized prostatic cancer mouse model to docetaxel by increasing the expression of FOXO3.
References
Ref 1 MicroRNA-223-3p regulates cell chemo-sensitivity by targeting FOXO3 in prostatic cancer. Gene. 2018 Jun 5;658:152-158. doi: 10.1016/j.gene.2018.03.013. Epub 2018 Mar 5.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.