Molecule Information
General Information of the Molecule (ID: Mol01590)
Name |
hsa-miR-223-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 223
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGUCAGUUUGUCAAAUACCCCA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prostate cancer | [1] | |||
Sensitive Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Sensitive Drug | Docetaxel | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
LNCaP cells | Prostate | Homo sapiens (Human) | CVCL_0395 | |
PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
C4-2 cells | Prostate | Homo sapiens (Human) | CVCL_4782 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qrt-PCR | |||
Experiment for Drug Resistance |
MTT assay; TUNEL assay; Flow cytometry assay | |||
Mechanism Description | miR-223-3p inhibitor sensitized prostatic cancer mouse model to docetaxel by increasing the expression of FOXO3. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.