Molecule Information

General Information of the Molecule (ID: Mol01590)

• Name: hsa-miR-223-3p ,Homo sapiens
• Synonyms: microRNA 223
• Molecule Type: Mature miRNA
• Sequence: UGUCAGUUUGUCAAAUACCCCA
• Ensembl ID: ENSG00000284567
• HGNC ID: HGNC:31603
• Mature Accession: MIMAT0000280

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [1]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: C4-2 cells; Prostate; Homo sapiens (Human); CVCL_4782
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qrt-PCR
• Experiment for Drug Resistance: MTT assay; TUNEL assay; Flow cytometry assay
• Mechanism Description: miR-223-3p inhibitor sensitized prostatic cancer mouse model to docetaxel by increasing the expression of FOXO3.

References

• Ref 1: MicroRNA-223-3p regulates cell chemo-sensitivity by targeting FOXO3 in prostatic cancer. Gene. 2018 Jun 5;658:152-158. doi: 10.1016/j.gene.2018.03.013. Epub 2018 Mar 5.