Molecule Information
General Information of the Molecule (ID: Mol01589)
Name |
hsa-miR-221-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 221
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AGCUACAUUGUCUGCUGGGUUUC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic cancer | [1] | |||
Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
PATU8988 cells | Pancreas | Homo sapiens (Human) | CVCL_1846 | |
293TN cells | Pancreas | Homo sapiens (Human) | CVCL_UL49 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
5-FU and gemcitabine assay; CCK8 assay; Wound healing assay; Transwell chamber invasion assay | |||
Mechanism Description | miRNA-221-3p desensitizes pancreatic cancer cells to 5-fluorouracil by targeting RB1. miR221-3p down-regulated RB1 expression by directly binding to its 3'-UTR and therefore caused increased several aspects of pancreatic cancer pathogenesis, including proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT). |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.