Molecule Information

General Information of the Molecule (ID: Mol01587)

• Name: hsa-miR-219a-5p ,Homo sapiens
• Synonyms: microRNA 219a-1
• Molecule Type: Mature miRNA
• Sequence: UGAUUGUCCAAACGCAAUUCU
• Ensembl ID: ENSG00000199036
• HGNC ID: HGNC:31597
• Mature Accession: MIMAT0000276

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay
• Mechanism Description: miR-219a-5p enhances cisplatin sensitivity of human non-small cell lung cancer by targeting FGF9.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [2]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: NCM460 cells; Colon; Homo sapiens (Human); CVCL_0460
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Luciferase assay; Wound healing assay; Transwell assay; Flow cytometry assay
• Mechanism Description: The aberrant expression of miR-219-5p and Sall4 in colon cancer specimens, and confirmed that Sall4 was the direct target of miR-219-5p. Additionally, by aid of gain and loss of function assays, miR-219-5p was observed to play an inhibitory effect on cell proliferation, invasion and drug resistance.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [2]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: NCM460 cells; Colon; Homo sapiens (Human); CVCL_0460
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Luciferase assay; Wound healing assay; Transwell assay; Flow cytometry assay
• Mechanism Description: The aberrant expression of miR-219-5p and Sall4 in colon cancer specimens, and confirmed that Sall4 was the direct target of miR-219-5p. Additionally, by aid of gain and loss of function assays, miR-219-5p was observed to play an inhibitory effect on cell proliferation, invasion and drug resistance.

References

• Ref 1: MiR-219a-5p enhances cisplatin sensitivity of human non-small cell lung cancer by targeting FGF9. Biomed Pharmacother. 2019 Jun;114:108662. doi: 10.1016/j.biopha.2019.108662. Epub 2019 Apr 15.
• Ref 2: miR-219-5p plays a tumor suppressive role in colon cancer by targeting oncogene Sall4. Oncol Rep. 2015 Oct;34(4):1923-32. doi: 10.3892/or.2015.4168. Epub 2015 Aug 4.