General Information of the Molecule (ID: Mol01587)
Name
hsa-miR-219a-5p ,Homo sapiens
Synonyms
microRNA 219a-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGAUUGUCCAAACGCAAUUCU
    Click to Show/Hide
Ensembl ID
ENSG00000199036
HGNC ID
HGNC:31597
Mature Accession
MIMAT0000276
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assay
Mechanism Description miR-219a-5p enhances cisplatin sensitivity of human non-small cell lung cancer by targeting FGF9.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [2]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
NCM460 cells Colon Homo sapiens (Human) CVCL_0460
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Luciferase assay; Wound healing assay; Transwell assay; Flow cytometry assay
Mechanism Description The aberrant expression of miR-219-5p and Sall4 in colon cancer specimens, and confirmed that Sall4 was the direct target of miR-219-5p. Additionally, by aid of gain and loss of function assays, miR-219-5p was observed to play an inhibitory effect on cell proliferation, invasion and drug resistance.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [2]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
NCM460 cells Colon Homo sapiens (Human) CVCL_0460
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Luciferase assay; Wound healing assay; Transwell assay; Flow cytometry assay
Mechanism Description The aberrant expression of miR-219-5p and Sall4 in colon cancer specimens, and confirmed that Sall4 was the direct target of miR-219-5p. Additionally, by aid of gain and loss of function assays, miR-219-5p was observed to play an inhibitory effect on cell proliferation, invasion and drug resistance.
References
Ref 1 MiR-219a-5p enhances cisplatin sensitivity of human non-small cell lung cancer by targeting FGF9. Biomed Pharmacother. 2019 Jun;114:108662. doi: 10.1016/j.biopha.2019.108662. Epub 2019 Apr 15.
Ref 2 miR-219-5p plays a tumor suppressive role in colon cancer by targeting oncogene Sall4. Oncol Rep. 2015 Oct;34(4):1923-32. doi: 10.3892/or.2015.4168. Epub 2015 Aug 4.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.