Molecule Information

General Information of the Molecule (ID: Mol01581)

• Name: hsa-miR-204-5p ,Homo sapiens
• Synonyms: microRNA 204
• Molecule Type: Mature miRNA
• Sequence: UUCCCUUUGUCAUCCUAUGCCU
• Ensembl ID: ENSG00000207935
• HGNC ID: HGNC:31582
• Mature Accession: MIMAT0000265

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: UCA1/miR204-5p ceRNA signaling pathway; Regulation; hsa05206
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Western blot analysis
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p.We found that UCA1 was up-regulated in CRCs and negatively correlated with survival time in two CRC cohorts. Further mechanistic studies revealed that UCA1 could sponge endogenous miR-204-5p and inhibit its activity. We also identified CREB1 as a new target of miR-204-5p. The protein levels of CREB1 were significantly up-regulated in CRCs, negatively associated with survival time and positively correlated with the UCA1 expression. The present work provides the first evidence of a UCA1-miR-204-5p-CREB1/BCL2/RAB22A regulatory network in CRC and reveals that UCA1 and CREB1 are potential new oncogenes and prognostic factors for CRC.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: UCA1/miR204-5p ceRNA signaling pathway; Regulation; hsa05206
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Northern blot analysis
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p.We found that UCA1 was up-regulated in CRCs and negatively correlated with survival time in two CRC cohorts. Further mechanistic studies revealed that UCA1 could sponge endogenous miR-204-5p and inhibit its activity. We also identified CREB1 as a new target of miR-204-5p. The protein levels of CREB1 were significantly up-regulated in CRCs, negatively associated with survival time and positively correlated with the UCA1 expression. The present work provides the first evidence of a UCA1-miR-204-5p-CREB1/BCL2/RAB22A regulatory network in CRC and reveals that UCA1 and CREB1 are potential new oncogenes and prognostic factors for CRC.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [2]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: miR204-5p/RAB22A signaling pathway; Regulation; hsa05206
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-204-5p is frequently downregulated in colorectal cancer tissues, and survival analysis showed that the downregulation of miR-204-5p in colorectal cancer was associated with poor prognoses. Ectopic miR-204-5p expression repressed colorectal cancer cell growth both in vitro and in vivo. Moreover, restoring miR-204-5p expression inhibited colorectal cancer migration and invasion and promoted tumor sensitivity to chemotherapy. Mechanistic investigations revealed that RAB22A, a member of the RAS oncogene family, is a direct functional target of miR-204-5p in colorectal cancer. Furthermore, RAB22A protein levels in colorectal cancer tissues were frequently increased and negatively associated with miR-204-5p levels and survival time.

Vemurafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [3]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Vemurafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: ERK1/2/MEK activation signaling pathway|hsa04210); Regulation
• Cell Pathway Regulation: MAPK signaling pathway; Activation; hsa04010
• Cell Pathway Regulation: PI3K signaling pathway; Activation; hsa04151
• Cell Pathway Regulation: RAS signaling pathway; Activation; hsa04014
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR204-5p and miR211-5p contribute to BRAF inhibitor resistance in melanoma. MTT assays revealed a moderate but consistent increase in resistance to VMF in cells overexpressing miR211-5p or miR204-5p. Joint overexpression of miR204-5p and miR211-5p durably stimulated Ras and MAPk upregulation. Resistance to BRAFi in melanoma involves genetic alterations that lead to reactivation of the MAPk pathway or activation of PI3-k/AkT signalling.

References

• Ref 1: LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p. Sci Rep. 2016 Apr 5;6:23892. doi: 10.1038/srep23892.
• Ref 2: miR-204-5p inhibits proliferation and invasion and enhances chemotherapeutic sensitivity of colorectal cancer cells by downregulating RAB22A. Clin Cancer Res. 2014 Dec 1;20(23):6187-99. doi: 10.1158/1078-0432.CCR-14-1030. Epub 2014 Oct 7.
• Ref 3: miR-204-5p and miR-211-5p Contribute to BRAF Inhibitor Resistance in Melanoma. Cancer Res. 2018 Feb 15;78(4):1017-1030. doi: 10.1158/0008-5472.CAN-17-1318. Epub 2017 Dec 11.