Molecule Information
General Information of the Molecule (ID: Mol01581)
| Name |
hsa-miR-204-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 204
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UUCCCUUUGUCAUCCUAUGCCU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] | [1] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 |
| H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | This gene is up-regulated in cisplatin-resistance cells | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [2] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| UCA1/miR204-5p ceRNA signaling pathway | Regulation | N.A. | ||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
Western blot analysis | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p.We found that UCA1 was up-regulated in CRCs and negatively correlated with survival time in two CRC cohorts. Further mechanistic studies revealed that UCA1 could sponge endogenous miR-204-5p and inhibit its activity. We also identified CREB1 as a new target of miR-204-5p. The protein levels of CREB1 were significantly up-regulated in CRCs, negatively associated with survival time and positively correlated with the UCA1 expression. The present work provides the first evidence of a UCA1-miR-204-5p-CREB1/BCL2/RAB22A regulatory network in CRC and reveals that UCA1 and CREB1 are potential new oncogenes and prognostic factors for CRC. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [2] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| UCA1/miR204-5p ceRNA signaling pathway | Regulation | N.A. | ||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; Northern blot analysis | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p.We found that UCA1 was up-regulated in CRCs and negatively correlated with survival time in two CRC cohorts. Further mechanistic studies revealed that UCA1 could sponge endogenous miR-204-5p and inhibit its activity. We also identified CREB1 as a new target of miR-204-5p. The protein levels of CREB1 were significantly up-regulated in CRCs, negatively associated with survival time and positively correlated with the UCA1 expression. The present work provides the first evidence of a UCA1-miR-204-5p-CREB1/BCL2/RAB22A regulatory network in CRC and reveals that UCA1 and CREB1 are potential new oncogenes and prognostic factors for CRC. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [3] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| miR204-5p/RAB22A signaling pathway | Regulation | N.A. | ||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| DLD1 cells | Colon | Homo sapiens (Human) | CVCL_0248 | |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| CaCo2 cells | Colon | Homo sapiens (Human) | CVCL_0025 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-204-5p is frequently downregulated in colorectal cancer tissues, and survival analysis showed that the downregulation of miR-204-5p in colorectal cancer was associated with poor prognoses. Ectopic miR-204-5p expression repressed colorectal cancer cell growth both in vitro and in vivo. Moreover, restoring miR-204-5p expression inhibited colorectal cancer migration and invasion and promoted tumor sensitivity to chemotherapy. Mechanistic investigations revealed that RAB22A, a member of the RAS oncogene family, is a direct functional target of miR-204-5p in colorectal cancer. Furthermore, RAB22A protein levels in colorectal cancer tissues were frequently increased and negatively associated with miR-204-5p levels and survival time. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Melanoma [ICD-11: 2C30.0] | [4] | |||
| Resistant Disease | Melanoma [ICD-11: 2C30.0] | |||
| Resistant Drug | Vemurafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | ERK1/2/MEK activation signaling pathway|hsa04210) | Regulation | N.A. | |
| MAPK signaling pathway | Activation | hsa04010 | ||
| PI3K signaling pathway | Activation | hsa04151 | ||
| RAS signaling pathway | Activation | hsa04014 | ||
| In Vitro Model | A375 cells | Skin | Homo sapiens (Human) | CVCL_0132 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR204-5p and miR211-5p contribute to BRAF inhibitor resistance in melanoma. MTT assays revealed a moderate but consistent increase in resistance to VMF in cells overexpressing miR211-5p or miR204-5p. Joint overexpression of miR204-5p and miR211-5p durably stimulated Ras and MAPk upregulation. Resistance to BRAFi in melanoma involves genetic alterations that lead to reactivation of the MAPk pathway or activation of PI3-k/AkT signalling. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
