General Information of the Molecule (ID: Mol01581)
Name
hsa-miR-204-5p ,Homo sapiens
Synonyms
microRNA 204
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UUCCCUUUGUCAUCCUAUGCCU
    Click to Show/Hide
Ensembl ID
ENSG00000207935
HGNC ID
HGNC:31582
Mature Accession
MIMAT0000265
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [1]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
UCA1/miR204-5p ceRNA signaling pathway Regulation hsa05206
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p.We found that UCA1 was up-regulated in CRCs and negatively correlated with survival time in two CRC cohorts. Further mechanistic studies revealed that UCA1 could sponge endogenous miR-204-5p and inhibit its activity. We also identified CREB1 as a new target of miR-204-5p. The protein levels of CREB1 were significantly up-regulated in CRCs, negatively associated with survival time and positively correlated with the UCA1 expression. The present work provides the first evidence of a UCA1-miR-204-5p-CREB1/BCL2/RAB22A regulatory network in CRC and reveals that UCA1 and CREB1 are potential new oncogenes and prognostic factors for CRC.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [1]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
UCA1/miR204-5p ceRNA signaling pathway Regulation hsa05206
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Northern blot analysis
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p.We found that UCA1 was up-regulated in CRCs and negatively correlated with survival time in two CRC cohorts. Further mechanistic studies revealed that UCA1 could sponge endogenous miR-204-5p and inhibit its activity. We also identified CREB1 as a new target of miR-204-5p. The protein levels of CREB1 were significantly up-regulated in CRCs, negatively associated with survival time and positively correlated with the UCA1 expression. The present work provides the first evidence of a UCA1-miR-204-5p-CREB1/BCL2/RAB22A regulatory network in CRC and reveals that UCA1 and CREB1 are potential new oncogenes and prognostic factors for CRC.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [2]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
miR204-5p/RAB22A signaling pathway Regulation hsa05206
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-204-5p is frequently downregulated in colorectal cancer tissues, and survival analysis showed that the downregulation of miR-204-5p in colorectal cancer was associated with poor prognoses. Ectopic miR-204-5p expression repressed colorectal cancer cell growth both in vitro and in vivo. Moreover, restoring miR-204-5p expression inhibited colorectal cancer migration and invasion and promoted tumor sensitivity to chemotherapy. Mechanistic investigations revealed that RAB22A, a member of the RAS oncogene family, is a direct functional target of miR-204-5p in colorectal cancer. Furthermore, RAB22A protein levels in colorectal cancer tissues were frequently increased and negatively associated with miR-204-5p levels and survival time.
Vemurafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [3]
Resistant Disease Melanoma [ICD-11: 2C30.0]
Resistant Drug Vemurafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ERK1/2/MEK activation signaling pathway|hsa04210) Regulation
MAPK signaling pathway Activation hsa04010
PI3K signaling pathway Activation hsa04151
RAS signaling pathway Activation hsa04014
In Vitro Model A375 cells Skin Homo sapiens (Human) CVCL_0132
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR204-5p and miR211-5p contribute to BRAF inhibitor resistance in melanoma. MTT assays revealed a moderate but consistent increase in resistance to VMF in cells overexpressing miR211-5p or miR204-5p. Joint overexpression of miR204-5p and miR211-5p durably stimulated Ras and MAPk upregulation. Resistance to BRAFi in melanoma involves genetic alterations that lead to reactivation of the MAPk pathway or activation of PI3-k/AkT signalling.
References
Ref 1 LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p. Sci Rep. 2016 Apr 5;6:23892. doi: 10.1038/srep23892.
Ref 2 miR-204-5p inhibits proliferation and invasion and enhances chemotherapeutic sensitivity of colorectal cancer cells by downregulating RAB22A. Clin Cancer Res. 2014 Dec 1;20(23):6187-99. doi: 10.1158/1078-0432.CCR-14-1030. Epub 2014 Oct 7.
Ref 3 miR-204-5p and miR-211-5p Contribute to BRAF Inhibitor Resistance in Melanoma. Cancer Res. 2018 Feb 15;78(4):1017-1030. doi: 10.1158/0008-5472.CAN-17-1318. Epub 2017 Dec 11.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.