General Information of the Molecule (ID: Mol01577)
Name
hsa-miR-181c-5p ,Homo sapiens
Synonyms
microRNA 181c
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AACAUUCAACCUGUCGGUGAGU
    Click to Show/Hide
Ensembl ID
ENSG00000207613
HGNC ID
HGNC:31552
Mature Accession
MIMAT0000258
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [1]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Hippo signaling pathway Inhibition hsa04390
In Vitro Model SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
5-FU cells Colon Homo sapiens (Human) CVCL_1846
PATU8988 Pancreas Homo sapiens (Human) CVCL_1847
PATU8988 cells Pancreas Homo sapiens (Human) CVCL_1846
SW1990/GEM cells Pancreas Homo sapiens (Human) CVCL_ZW98
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Long non-coding RNA GAS5 antagonizes the chemoresistance of pancreatic cancer cells through down-regulation of miR181c-5p. GAS5 negatively regulated miR181c-5p, and miR181c-5p dramatically promoted pancreatic cancer cell chemoresistance through inactivating the Hippo signaling.
References
Ref 1 Long non-coding RNA GAS5 antagonizes the chemoresistance of pancreatic cancer cells through down-regulation of miR-181c-5p. Biomed Pharmacother. 2018 Jan;97:809-817. doi: 10.1016/j.biopha.2017.10.157. Epub 2017 Nov 6.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.