Molecule Information
General Information of the Molecule (ID: Mol01577)
Name |
hsa-miR-181c-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 181c
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AACAUUCAACCUGUCGGUGAGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic cancer | [1] | |||
Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Hippo signaling pathway | Inhibition | hsa04390 | |
In Vitro Model | SW1990 cells | Pancreas | Homo sapiens (Human) | CVCL_1723 |
5-FU cells | Colon | Homo sapiens (Human) | CVCL_1846 | |
PATU8988 | Pancreas | Homo sapiens (Human) | CVCL_1847 | |
PATU8988 cells | Pancreas | Homo sapiens (Human) | CVCL_1846 | |
SW1990/GEM cells | Pancreas | Homo sapiens (Human) | CVCL_ZW98 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Long non-coding RNA GAS5 antagonizes the chemoresistance of pancreatic cancer cells through down-regulation of miR181c-5p. GAS5 negatively regulated miR181c-5p, and miR181c-5p dramatically promoted pancreatic cancer cell chemoresistance through inactivating the Hippo signaling. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.