Molecule Information
General Information of the Molecule (ID: Mol01573)
| Name |
hsa-miR-10a-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 10a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UACCCUGUAGAUCCGAAUUUGUG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | [1] | |||
| Resistant Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell viability | Activation | hsa05200 | ||
| Epithelial mesenchymal transition signaling pathway | Activation | hsa01521 | ||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 | |
| PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| AsPC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0152 | |
| Su.86.86 cells | Pancreas | Homo sapiens (Human) | CVCL_3881 | |
| T3M4 cells | Pancreas | Homo sapiens (Human) | CVCL_4056 | |
| In Vivo Model | Nude mouse model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay; Transwell assay | |||
| Mechanism Description | Transcription factor activating protein 2 gamma (TFAP2C) is a target of miR-10a-5p, and TFAP2C overexpression resensitizes PDAC cells to gemcitabine, which is initiated by miR-10a-5p. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
