Molecule Information
General Information of the Molecule (ID: Mol01573)
Name |
hsa-miR-10a-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 10a
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UACCCUGUAGAUCCGAAUUUGUG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic ductal adenocarcinoma | [1] | |||
Resistant Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell viability | Activation | hsa05200 | ||
Epithelial mesenchymal transition signaling pathway | Activation | hsa01521 | ||
In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 | |
PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
AsPC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0152 | |
Su.86.86 cells | Pancreas | Homo sapiens (Human) | CVCL_3881 | |
T3M4 cells | Pancreas | Homo sapiens (Human) | CVCL_4056 | |
In Vivo Model | Nude mouse model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay; Transwell assay | |||
Mechanism Description | Transcription factor activating protein 2 gamma (TFAP2C) is a target of miR-10a-5p, and TFAP2C overexpression resensitizes PDAC cells to gemcitabine, which is initiated by miR-10a-5p. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.