General Information of the Molecule (ID: Mol01573)
Name
hsa-miR-10a-5p ,Homo sapiens
Synonyms
microRNA 10a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UACCCUGUAGAUCCGAAUUUGUG
    Click to Show/Hide
Ensembl ID
ENSG00000284038
HGNC ID
HGNC:31497
Mature Accession
MIMAT0000253
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [1]
Resistant Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell viability Activation hsa05200
Epithelial mesenchymal transition signaling pathway Activation hsa01521
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
Su.86.86 cells Pancreas Homo sapiens (Human) CVCL_3881
T3M4 cells Pancreas Homo sapiens (Human) CVCL_4056
In Vivo Model Nude mouse model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay; Transwell assay
Mechanism Description Transcription factor activating protein 2 gamma (TFAP2C) is a target of miR-10a-5p, and TFAP2C overexpression resensitizes PDAC cells to gemcitabine, which is initiated by miR-10a-5p.
References
Ref 1 MiR-10a-5p targets TFAP2C to promote gemcitabine resistance in pancreatic ductal adenocarcinoma. J Exp Clin Cancer Res. 2018 Apr 3;37(1):76. doi: 10.1186/s13046-018-0739-x.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.