Molecule Information
General Information of the Molecule (ID: Mol01569)
| Name |
hsa-miR-148a-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 148a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UCAGUGCACUACAGAACUUUGU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| BGC823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
| BGC823CDDP cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
| SGC7901CDDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; PI/Annexin V-FITC Apoptosis Detection kit assay | |||
| Mechanism Description | miR148a-3p reconstitution sensitized CDDP-resistant cells to CDDP treatment through promoting mitochondrial fission and decreasing AkAP1 expression level; miR148a-3p reconstitution in CDDP-resistant cells inhibits the cyto-protective autophagy by suppressing RAB12 expression and mTOR1 activation. miR148a-3p sensitization of GC cells to CDDP in vivo includes suppression of AkAP1 and RAB12 expression levels. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| p53 signaling pathway | Activation | hsa04115 | ||
| In Vitro Model | KYSE-270 cells | Esophagus | Homo sapiens (Human) | CVCL_1350 |
| KYSE-410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | The effect of miR-148a-3p downregulation on enhancement of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the increase of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. | |||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | p53 signaling pathway | Activation | hsa04115 | |
| In Vitro Model | KYSE-270 cells | Esophagus | Homo sapiens (Human) | CVCL_1350 |
| KYSE-410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | The effect of miR-148a-3p upregulation on suppression of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the inhibition of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [3] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | MAPK signalling pathway | Regulation | N.A. | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
MiRNA microarray analyses, qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| p53 signaling pathway | Activation | hsa04115 | ||
| In Vitro Model | KYSE-270 cells | Esophagus | Homo sapiens (Human) | CVCL_1350 |
| KYSE-410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | The effect of miR-148a-3p downregulation on enhancement of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the increase of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. | |||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | p53 signaling pathway | Activation | hsa04115 | |
| In Vitro Model | KYSE-270 cells | Esophagus | Homo sapiens (Human) | CVCL_1350 |
| KYSE-410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | The effect of miR-148a-3p upregulation on suppression of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the inhibition of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [3] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | MAPK signalling pathway | Regulation | N.A. | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
MiRNA microarray analyses, qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
