General Information of the Molecule (ID: Mol01569)
Name
hsa-miR-148a-3p ,Homo sapiens
Synonyms
microRNA 148a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCAGUGCACUACAGAACUUUGU
    Click to Show/Hide
Ensembl ID
ENSG00000199085
HGNC ID
HGNC:31535
Mature Accession
MIMAT0000243
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
BGC823CDDP cells Gastric Homo sapiens (Human) CVCL_3360
SGC7901CDDP cells Gastric Homo sapiens (Human) CVCL_0520
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; PI/Annexin V-FITC Apoptosis Detection kit assay
Mechanism Description miR148a-3p reconstitution sensitized CDDP-resistant cells to CDDP treatment through promoting mitochondrial fission and decreasing AkAP1 expression level; miR148a-3p reconstitution in CDDP-resistant cells inhibits the cyto-protective autophagy by suppressing RAB12 expression and mTOR1 activation. miR148a-3p sensitization of GC cells to CDDP in vivo includes suppression of AkAP1 and RAB12 expression levels.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [2]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
p53 signaling pathway Activation hsa04115
In Vitro Model KYSE-270 cells Esophagus Homo sapiens (Human) CVCL_1350
KYSE-410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description The effect of miR-148a-3p downregulation on enhancement of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the increase of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [2]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation p53 signaling pathway Activation hsa04115
In Vitro Model KYSE-270 cells Esophagus Homo sapiens (Human) CVCL_1350
KYSE-410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description The effect of miR-148a-3p upregulation on suppression of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the inhibition of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0] [3]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation MAPK signalling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
MiRNA microarray analyses, qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [2]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
p53 signaling pathway Activation hsa04115
In Vitro Model KYSE-270 cells Esophagus Homo sapiens (Human) CVCL_1350
KYSE-410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description The effect of miR-148a-3p downregulation on enhancement of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the increase of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [2]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation p53 signaling pathway Activation hsa04115
In Vitro Model KYSE-270 cells Esophagus Homo sapiens (Human) CVCL_1350
KYSE-410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description The effect of miR-148a-3p upregulation on suppression of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the inhibition of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0] [3]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation MAPK signalling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
MiRNA microarray analyses, qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.
References
Ref 1 MicroRNA-148a-3p enhances cisplatin cytotoxicity in gastric cancer through mitochondrial fission induction and cyto-protective autophagy suppression. Cancer Lett. 2017 Dec 1;410:212-227. doi: 10.1016/j.canlet.2017.09.035. Epub 2017 Sep 28.
Ref 2 Complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. Sci Rep. 2018 Dec 3;8(1):17553. doi: 10.1038/s41598-018-35799-1.
Ref 3 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.