Molecule Information
General Information of the Molecule (ID: Mol01563)
| Name |
hsa-miR-196a-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 196a-1
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UAGGUAGUUUCAUGUUGUUGGG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [1] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
| UMUC-2 cells | Bladder | Homo sapiens (Human) | CVCL_8155 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Annexin V-FITC/PI Apoptosis assay | |||
| Mechanism Description | Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR196a-5p in bladder cancer cells. UCA1 upregulates miR196a-5p through transcription factor CREB. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [1] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
| UMUC-2 cells | Bladder | Homo sapiens (Human) | CVCL_8155 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Annexin V-FITC/PI Apoptosis assay | |||
| Mechanism Description | Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR196a-5p in bladder cancer cells. UCA1 upregulates miR196a-5p through transcription factor CREB. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
