General Information of the Molecule (ID: Mol01560)
Name
hsa-miR-101-3p ,Homo sapiens
Synonyms
microRNA 101-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UACAGUACUGUGAUAACUGAA
    Click to Show/Hide
Ensembl ID
ENSG00000199135
HGNC ID
HGNC:31488
Mature Accession
MIMAT0000099
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [1]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Long-term treatment of PDA cells with gemcitabine induced pronounced therapy resistance. The RRM1 gene is a major mediator of resistance and its expression is regulated by direct binding of miR-101-3p to two binding sites in the RRM1 3'UTR. The overexpression of miR-101-3p mimics inhibited the expression of RRM1 and partially reversed gemcitabine-resistance.
References
Ref 1 MicroRNA-101-3p reverses gemcitabine resistance by inhibition of ribonucleotide reductase M1 in pancreatic cancer. Cancer Lett. 2016 Apr 1;373(1):130-137. doi: 10.1016/j.canlet.2016.01.038. Epub 2016 Jan 28.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.