Molecule Information

General Information of the Molecule (ID: Mol01560)

• Name: hsa-miR-101-3p ,Homo sapiens
• Synonyms: microRNA 101-1
• Molecule Type: Mature miRNA
• Sequence: UACAGUACUGUGAUAACUGAA
• Ensembl ID: ENSG00000199135
• HGNC ID: HGNC:31488
• Mature Accession: MIMAT0000099

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Squamous cell carcinoma [ICD-11: 2B6E.3] [1]

• Resistant Disease: Squamous cell carcinoma [ICD-11: 2B6E.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Necrotic apoptosis pathway; Regulation; N.A.
• Experiment for Molecule Alteration: Immunoblotting; immunoprecipitation; Luciferase reporter assays
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Modulation of RIPK1 with miR-101-3p mimic or inhibitor, as well as with siRNA, or chemical inhibitors was shown to affect sensitivity of SCC cells to cisplatin.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [2]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Long-term treatment of PDA cells with gemcitabine induced pronounced therapy resistance. The RRM1 gene is a major mediator of resistance and its expression is regulated by direct binding of miR-101-3p to two binding sites in the RRM1 3'UTR. The overexpression of miR-101-3p mimics inhibited the expression of RRM1 and partially reversed gemcitabine-resistance.

Mitoxantrone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Mitoxantrone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BT-20 cells; Mammary gland; Homo sapiens (Human); CVCL_0178
• In Vitro Model: BT-474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: BT-549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: CAMA-1 cells; Breast; Homo sapiens (Human); CVCL_1115
• In Vitro Model: HCC1143 cells; Breast; Homo sapiens (Human); CVCL_1245
• In Vitro Model: HCC1806 cells; Breast; Homo sapiens (Human); CVCL_1258
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• In Vitro Model: HCC1954 cells; Breast; Homo sapiens (Human); CVCL_1259
• In Vitro Model: HCC38 cells; Breast; Homo sapiens (Human); CVCL_1267
• In Vitro Model: HCC70 cells; Breast; Homo sapiens (Human); CVCL_1270
• In Vitro Model: Hs578T cells; Breast; Homo sapiens (Human); CVCL_0332
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-361 cells; Breast; Homo sapiens (Human); CVCL_0620
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: SK-BR-3 cells; Pleural effusion; Homo sapiens (Human); CVCL_0033
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: EVSA-T cells; Ascites; Homo sapiens (Human); CVCL_1207
• In Vitro Model: Sk-BR-7 cells; Breast; Homo sapiens (Human); CVCL_5218
• In Vitro Model: SUM159PT cells; Breast; Homo sapiens (Human); CVCL_5423/CVCL_5590
• In Vitro Model: SUM44PE cells; Breast; Homo sapiens (Human); CVCL_3424
• In Vitro Model: SUM52PE cells; Breast; Homo sapiens (Human); CVCL_3425
• Experiment for Molecule Alteration: Microarray analyses
• Mechanism Description: This gene is up-regulated in mitoxantrone-resistance cells

References

• Ref 1: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 2: MicroRNA-101-3p reverses gemcitabine resistance by inhibition of ribonucleotide reductase M1 in pancreatic cancer. Cancer Lett. 2016 Apr 1;373(1):130-137. doi: 10.1016/j.canlet.2016.01.038. Epub 2016 Jan 28.
• Ref 3: Alterations in p53 predict response to preoperative high dose chemotherapy in patients with gastric cancerMol Pathol. 2003 Oct;56(5):286-92. doi: 10.1136/mp.56.5.286.