Molecule Information

General Information of the Molecule (ID: Mol01556)

• Name: hsa-miR-96-5p ,Homo sapiens
• Synonyms: microRNA 96
• Molecule Type: Mature miRNA
• Sequence: UUUGGCACUAGCACAUUUUUGCU
• Ensembl ID: ENSG00000199158
• HGNC ID: HGNC:31648
• Mature Accession: MIMAT0000095

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: Microarray analyses; Luciferase reporter assay; Western blot
• Experiment for Drug Resistance: Cell proliferation assays; MTT assay

Clinical Trial Drug(s) 1 drug(s) in total

PLX4720

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [2]

• Resistant Disease: Papillary thyroid carcinoma [ICD-11: 2D10.1]
• Resistant Drug: PLX4720
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Immunoblot analysis; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: This gene is up-regulated in PLX4720-resistance cells

References

• Ref 1: A panel of serum exosomal microRNAs as predictive markers for chemoresistance in advanced colorectal cancer. Cancer Chemother Pharmacol. 2019 Aug;84(2):315-325. doi: 10.1007/s00280-019-03867-6. Epub 2019 May 14.
• Ref 2: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.