General Information of the Molecule (ID: Mol01554)
Name
hsa-miR-32-5p ,Homo sapiens
Synonyms
microRNA 32
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAUUGCACAUUACUAAGUUGCA
    Click to Show/Hide
Ensembl ID
ENSG00000207698
HGNC ID
HGNC:31631
Mature Accession
MIMAT0000090
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
Cell viability Activation hsa05200
PI3K/AKT signaling pathway Activation hsa04151
In Vitro Model BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
MHCC97-H cells Liver Homo sapiens (Human) CVCL_4972
Bel/5-FU cells Liver Homo sapiens (Human) CVCL_5493
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Wound healing assay; Transwell assay
Mechanism Description Over-expression of miR-32-5p activated the PI3k/Akt pathway by suppressing PTEN and induced multidrug resistance via exosomes through promoting angiogenesis and epithelial-mesenchymal transition.
References
Ref 1 Exosomal microRNA-32-5p induces multidrug resistance in hepatocellular carcinoma via the PI3K/Akt pathway. J Exp Clin Cancer Res. 2018 Mar 12;37(1):52. doi: 10.1186/s13046-018-0677-7.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.