Molecule Information

General Information of the Molecule (ID: Mol01553)

• Name: hsa-miR-30a-5p ,Homo sapiens
• Synonyms: microRNA 30a
• Molecule Type: Mature miRNA
• Sequence: UGUAAACAUCCUCGACUGGAAG
• Ensembl ID: ENSG00000207827
• HGNC ID: HGNC:31624
• Mature Accession: MIMAT0000087

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: COC1 cells; Ovary; Homo sapiens (Human); CVCL_6891
• In Vitro Model: SkOV3/DDP cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: COC1/DDP cells; Ovary; Homo sapiens (Human); CVCL_6892
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: High expression of miRNA-30a-5p was able to promote cell growth and colony forming ability, and enhance cell migration and invasion.

Disease Class: Melanoma [ICD-11: 2C30.0] [2]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/P53 signaling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: M8 cells; Skin; Homo sapiens (Human); N.A.
• In Vitro Model: Sk-Mel-19 cells; Skin; Homo sapiens (Human); CVCL_6025
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-30a-5p was over-expressed in cisplatin resistant melanoma cells and could influence the activity of PI3k/AkT and the protein level of P53 by targeting IGF1R gene.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [3]

• Sensitive Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• In Vitro Model: Letp cells; Lung; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; WB assay; Colony formation assay; Fow cytometric analysis
• Mechanism Description: Beclin-1-dependent autophagy in SCLC was directly regulated by miR30a-5p. miR30a-5p contributed to chemoresistance of SCLC cells partially in an Beclin-1-dependent manneRNA.

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: HO8910 cells; Ovary; Homo sapiens (Human); CVCL_6868
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vitro Model: ES2 cells; Ovary; Homo sapiens (Human); CVCL_AX39
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR30a/c-5p in turn directly inhibited DNMT1 as well as Snail. Forced expression of miR30a/c-5p or knocking down of DNMT1 and Snail promoted cisplatin susceptibility and partially reversed epithelial-mesenchymal transition (EMT) in CP70 cells.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [5]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: JAK-STAT signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: hsa04062; Regulation; N.A.
• Experiment for Molecule Alteration: Gene ontology (GO) and pathway analysis; Microarray data
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Through miRNA-mRNA targeting network, we found that BCL6, IRF4, CD80, and PRDM1 were common target genes of miR-30 family. The cBioPortal database showed that BCL6 had the highest level of genetic alterations among DLBCL. In addition, another expression profile from GEO database showed that BCL6 was significantly high expression in no responsive patients after Ibrutinib treatment, and the receiver operating characteristic (ROC) curve which was used to evaluate the relationship between BCL6 expression and its effect was 0.67. MTT assay showed that treatment with FX1 (a BCL6 inhibitor) can enhance the sensitivity of Ibrutinib in C481S BTK HBL-1 cells. The results suggested that BCL6 and miR-30 family maybe associate with Ibrutinib resistance in ABC-DLBCL.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [6]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: NCI-H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Annexin V-FITC Apoptosis assay; CytoSelect Cell Invasion Assay; Wound healing assay
• Mechanism Description: miR30a-5p overexpression targets the EGFR and insulin-like growth factor receptor-1 (IGF-1R) signaling pathways to overcome the drug resistance. The combination of EGFR and IGF-1R inhibitors treatment could block the PI3k/AkT signaling pathway.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [3]

• Sensitive Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• In Vitro Model: Letp cells; Lung; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; WB assay; Colony formation assay; Fow cytometric analysis
• Mechanism Description: Beclin-1-dependent autophagy in SCLC was directly regulated by miR30a-5p. miR30a-5p contributed to chemoresistance of SCLC cells partially in an Beclin-1-dependent manneRNA.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [6]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: NCI-H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Annexin V-FITC Apoptosis assay; CytoSelect Cell Invasion Assay; Wound healing assay
• Mechanism Description: miR30a-5p overexpression targets the EGFR and insulin-like growth factor receptor-1 (IGF-1R) signaling pathways to overcome the drug resistance. The combination of EGFR and IGF-1R inhibitors treatment could block the PI3k/AkT signaling pathway.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [7]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: A549/PR cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460/PR cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR30a-5p increases paclitaxel sensitivity by promoting chemotherapy-induced apoptosis via downregulating BCL-2.

References

• Ref 1: Expression of microRNA-30a-5p in drug-resistant and drug-sensitive ovarian cancer cell lines. Oncol Lett. 2016 Sep;12(3):2065-2070. doi: 10.3892/ol.2016.4831. Epub 2016 Jul 8.
• Ref 2: MiR-30a-5p confers cisplatin resistance by regulating IGF1R expression in melanoma cells. BMC Cancer. 2018 Apr 11;18(1):404. doi: 10.1186/s12885-018-4233-9.
• Ref 3: Intensified Beclin-1 Mediated by Low Expression of Mir-30a-5p Promotes Chemoresistance in Human Small Cell Lung Cancer. Cell Physiol Biochem. 2017;43(3):1126-1139. doi: 10.1159/000481754. Epub 2017 Oct 5.
• Ref 4: A Feedback Loop Between miR-30a/c-5p and DNMT1 Mediates Cisplatin Resistance in Ovarian Cancer Cells. Cell Physiol Biochem. 2017;41(3):973-986. doi: 10.1159/000460618. Epub 2017 Feb 21.
• Ref 5: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 6: MiR-30a-5p Overexpression May Overcome EGFR-Inhibitor Resistance through Regulating PI3K/AKT Signaling Pathway in Non-small Cell Lung Cancer Cell Lines. Front Genet. 2016 Nov 15;7:197. doi: 10.3389/fgene.2016.00197. eCollection 2016.
• Ref 7: miR-30a-5p enhances paclitaxel sensitivity in non-small cell lung cancer through targeting BCL-2 expression. J Mol Med (Berl). 2017 Aug;95(8):861-871. doi: 10.1007/s00109-017-1539-z. Epub 2017 May 9.