Molecule Information

General Information of the Molecule (ID: Mol01553)
Name
hsa-miR-30a-5p ,Homo sapiens
Synonyms
microRNA 30a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGUAAACAUCCUCGACUGGAAG
    Click to Show/Hide
Ensembl ID
ENSG00000207827
HGNC ID
HGNC:31624
Mature Accession
MIMAT0000087
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
COC1 cells Ovary Homo sapiens (Human) CVCL_6891
SkOV3/DDP cells Ovary Homo sapiens (Human) CVCL_0532
COC1/DDP cells Ovary Homo sapiens (Human) CVCL_6892
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description High expression of miRNA-30a-5p was able to promote cell growth and colony forming ability, and enhance cell migration and invasion.
Disease Class: Melanoma [ICD-11: 2C30.0] [2]
Resistant Disease Melanoma [ICD-11: 2C30.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT/P53 signaling pathway Regulation N.A.
Cell viability Activation hsa05200
In Vitro Model M8 cells Skin Homo sapiens (Human) N.A.
Sk-Mel-19 cells Skin Homo sapiens (Human) CVCL_6025
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-30a-5p was over-expressed in cisplatin resistant melanoma cells and could influence the activity of PI3k/AkT and the protein level of P53 by targeting IGF1R gene.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [3]
Sensitive Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model H446 cells Lung Homo sapiens (Human) CVCL_1562
Letp cells Lung Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; WB assay; Colony formation assay; Fow cytometric analysis
Mechanism Description Beclin-1-dependent autophagy in SCLC was directly regulated by miR30a-5p. miR30a-5p contributed to chemoresistance of SCLC cells partially in an Beclin-1-dependent manneRNA.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
HO8910 cells Ovary Homo sapiens (Human) CVCL_6868
CAOV3 cells Ovary Homo sapiens (Human) CVCL_0201
ES2 cells Ovary Homo sapiens (Human) CVCL_AX39
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometric analysis
Mechanism Description miR30a/c-5p in turn directly inhibited DNMT1 as well as Snail. Forced expression of miR30a/c-5p or knocking down of DNMT1 and Snail promoted cisplatin susceptibility and partially reversed epithelial-mesenchymal transition (EMT) in CP70 cells.
Erlotinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [5]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Erlotinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model NCI-H460 cells Lung Homo sapiens (Human) CVCL_0459
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Annexin V-FITC Apoptosis assay; CytoSelect Cell Invasion Assay; Wound healing assay
Mechanism Description miR30a-5p overexpression targets the EGFR and insulin-like growth factor receptor-1 (IGF-1R) signaling pathways to overcome the drug resistance. The combination of EGFR and IGF-1R inhibitors treatment could block the PI3k/AkT signaling pathway.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [3]
Sensitive Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Sensitive Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model H446 cells Lung Homo sapiens (Human) CVCL_1562
Letp cells Lung Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; WB assay; Colony formation assay; Fow cytometric analysis
Mechanism Description Beclin-1-dependent autophagy in SCLC was directly regulated by miR30a-5p. miR30a-5p contributed to chemoresistance of SCLC cells partially in an Beclin-1-dependent manneRNA.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [5]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model NCI-H460 cells Lung Homo sapiens (Human) CVCL_0459
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Annexin V-FITC Apoptosis assay; CytoSelect Cell Invasion Assay; Wound healing assay
Mechanism Description miR30a-5p overexpression targets the EGFR and insulin-like growth factor receptor-1 (IGF-1R) signaling pathways to overcome the drug resistance. The combination of EGFR and IGF-1R inhibitors treatment could block the PI3k/AkT signaling pathway.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [6]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
A549/PR cells Lung Homo sapiens (Human) CVCL_0023
H460/PR cells Lung Homo sapiens (Human) CVCL_0459
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometric analysis
Mechanism Description miR30a-5p increases paclitaxel sensitivity by promoting chemotherapy-induced apoptosis via downregulating BCL-2.
References
Ref 1 Expression of microRNA-30a-5p in drug-resistant and drug-sensitive ovarian cancer cell lines. Oncol Lett. 2016 Sep;12(3):2065-2070. doi: 10.3892/ol.2016.4831. Epub 2016 Jul 8.
Ref 2 MiR-30a-5p confers cisplatin resistance by regulating IGF1R expression in melanoma cells. BMC Cancer. 2018 Apr 11;18(1):404. doi: 10.1186/s12885-018-4233-9.
Ref 3 Intensified Beclin-1 Mediated by Low Expression of Mir-30a-5p Promotes Chemoresistance in Human Small Cell Lung Cancer. Cell Physiol Biochem. 2017;43(3):1126-1139. doi: 10.1159/000481754. Epub 2017 Oct 5.
Ref 4 A Feedback Loop Between miR-30a/c-5p and DNMT1 Mediates Cisplatin Resistance in Ovarian Cancer Cells. Cell Physiol Biochem. 2017;41(3):973-986. doi: 10.1159/000460618. Epub 2017 Feb 21.
Ref 5 MiR-30a-5p Overexpression May Overcome EGFR-Inhibitor Resistance through Regulating PI3K/AKT Signaling Pathway in Non-small Cell Lung Cancer Cell Lines. Front Genet. 2016 Nov 15;7:197. doi: 10.3389/fgene.2016.00197. eCollection 2016.
Ref 6 miR-30a-5p enhances paclitaxel sensitivity in non-small cell lung cancer through targeting BCL-2 expression. J Mol Med (Berl). 2017 Aug;95(8):861-871. doi: 10.1007/s00109-017-1539-z. Epub 2017 May 9.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.