Molecule Information
General Information of the Molecule (ID: Mol01551)
| Name |
hsa-miR-24-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 24-1
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGGCUCAGUUCAGCAGGAACAG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1] | [1] | |||
| Sensitive Disease | Head and neck squamous cell carcinoma [ICD-11: 2D42.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SCC15 cells | Tongue | Homo sapiens (Human) | CVCL_1681 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo assay | |||
| Mechanism Description | miR-24-3p is involved in regulating cell proliferation, clonogenecity and chemosensitivity in HNSCC cells. CHD5 is the critical downstream mediator implicated in this regulation. Importantly, miR-24-3p is upregulated in HNSCC patient samples. Inhibition of miR-24-3p conferred sensitivity to chemo drugs which was reversed with CHD5 knockdown. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
