General Information of the Molecule (ID: Mol01551)
Name
hsa-miR-24-3p ,Homo sapiens
Synonyms
microRNA 24-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGCUCAGUUCAGCAGGAACAG
    Click to Show/Hide
Ensembl ID
ENSG00000284459
HGNC ID
HGNC:31607
Mature Accession
MIMAT0000080
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [1]
Sensitive Disease Head and neck squamous cell carcinoma [ICD-11: 2D42.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SCC15 cells Tongue Homo sapiens (Human) CVCL_1681
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CellTiter-Glo assay
Mechanism Description miR-24-3p is involved in regulating cell proliferation, clonogenecity and chemosensitivity in HNSCC cells. CHD5 is the critical downstream mediator implicated in this regulation. Importantly, miR-24-3p is upregulated in HNSCC patient samples. Inhibition of miR-24-3p conferred sensitivity to chemo drugs which was reversed with CHD5 knockdown.
References
Ref 1 miRNA-24-3p promotes cell proliferation and regulates chemosensitivity in head and neck squamous cell carcinoma by targeting CHD5. Future Oncol. 2016 Dec;12(23):2701-2712. doi: 10.2217/fon-2016-0179. Epub 2016 Aug 11.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.