Molecule Information

General Information of the Molecule (ID: Mol01544)

• Name: hsa-let-7a-5p ,Homo sapiens
• Synonyms: microRNA let-7a-1
• Molecule Type: Mature miRNA
• Sequence: UGAGGUAGUAGGUUGUAUAGUU
• Ensembl ID: ENSG00000199165
• HGNC ID: HGNC:31476
• Mature Accession: MIMAT0000062

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] [1]

• Sensitive Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Regulation; N.A.
• Cell Pathway Regulation: MAPK/RAS signaling pathway; Inhibition; hsa04010
• In Vitro Model: 5-8F cells; Nasopharynx; Homo sapiens (Human); CVCL_C528
• In Vitro Model: CNE1 cells; Throat; Homo sapiens (Human); CVCL_6888
• In Vitro Model: S18 cells; Nasopharynx; Homo sapiens (Human); CVCL_B0U9
• In Vitro Model: Hk-1 cells; Nasopharyngeal; Homo sapiens (Human); CVCL_7047
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; EdU assay
• Mechanism Description: Upregulation of let-7a-5p reduced cell viability in S18 and 5-8F cells in the presence of 10 ug/ml cisplatin, which was reversed by upregulation of NEAT1;NEAT1 downregulates the expression of Rsf-1 through let-7a-5p.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [2]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: LncRNA LOXL1-AS1/miR-let-7a-5p/EGFR-related pathway regulates the doxorubicin resistance of prostate cancer DU-145 cells.

References

• Ref 1: LncRNA NEAT1/let-7a-5p axis regulates the cisplatin resistance in nasopharyngeal carcinoma by targeting Rsf-1 and modulating the Ras-MAPK pathway. Cancer Biol Ther. 2018 Jun 3;19(6):534-542. doi: 10.1080/15384047.2018.1450119. Epub 2018 Apr 9.
• Ref 2: LncRNA LOXL1-AS1/miR-let-7a-5p/EGFR-related pathway regulates the doxorubicin resistance of prostate cancer DU-145 cells. IUBMB Life. 2019 Oct;71(10):1537-1551. doi: 10.1002/iub.2075. Epub 2019 Jun 12.