General Information of the Molecule (ID: Mol01544)
Name
hsa-let-7a-5p ,Homo sapiens
Synonyms
microRNA let-7a-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGAGGUAGUAGGUUGUAUAGUU
    Click to Show/Hide
Ensembl ID
ENSG00000199165
HGNC ID
HGNC:31476
Mature Accession
MIMAT0000062
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] [1]
Sensitive Disease Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Regulation N.A.
MAPK/RAS signaling pathway Inhibition hsa04010
In Vitro Model 5-8F cells Nasopharynx Homo sapiens (Human) CVCL_C528
CNE1 cells Throat Homo sapiens (Human) CVCL_6888
S18 cells Nasopharynx Homo sapiens (Human) CVCL_B0U9
Hk-1 cells Nasopharyngeal Homo sapiens (Human) CVCL_7047
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; EdU assay
Mechanism Description Upregulation of let-7a-5p reduced cell viability in S18 and 5-8F cells in the presence of 10 ug/ml cisplatin, which was reversed by upregulation of NEAT1;NEAT1 downregulates the expression of Rsf-1 through let-7a-5p.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [2]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description LncRNA LOXL1-AS1/miR-let-7a-5p/EGFR-related pathway regulates the doxorubicin resistance of prostate cancer DU-145 cells.
References
Ref 1 LncRNA NEAT1/let-7a-5p axis regulates the cisplatin resistance in nasopharyngeal carcinoma by targeting Rsf-1 and modulating the Ras-MAPK pathway. Cancer Biol Ther. 2018 Jun 3;19(6):534-542. doi: 10.1080/15384047.2018.1450119. Epub 2018 Apr 9.
Ref 2 LncRNA LOXL1-AS1/miR-let-7a-5p/EGFR-related pathway regulates the doxorubicin resistance of prostate cancer DU-145 cells. IUBMB Life. 2019 Oct;71(10):1537-1551. doi: 10.1002/iub.2075. Epub 2019 Jun 12.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.