Molecule Information

General Information of the Molecule (ID: Mol01543)

• Name: hsa-mir-3656 ,Homo sapiens
• Synonyms: microRNA 3656
• Molecule Type: Precursor miRNA
• Sequence:
  CUUUCGGCCAGCGGGACGGCAUCCGAGGUGGGCUAGGCUCGGGCCCGUGGCGGGUGCGGG
  GGUGGGAGG
• HGNC ID: HGNC:38889
• Precursor Accession: MI0016056

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [1]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Activation; hsa01521
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: HPDE6-C7 cells; Pancreas; Homo sapiens (Human); CVCL_0P38
• In Vitro Model: HTERT-HPNE cells; Pancreas; Homo sapiens (Human); CVCL_C466
• In Vitro Model: PATU8988 cells; Pancreas; Homo sapiens (Human); CVCL_1846
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vitro Model: HPAC cells; Pancreas; Homo sapiens (Human); CVCL_3517
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR3656 expression enhances the chemosensitivity of pancreatic cancer to gemcitabine through modulation of the RHOF/EMT axis. miR3656 could target RHOF, a member of the Rho subfamily of small GTPases, and regulate the EMT process, enforced EMT progression via TWIST1 overexpression compromised the chemotherapy-enhancing effects of miR3656. Reduced miR3656 expression levels activated the EMT pathway through upregulation of RHOF, eventually causing drug resistance.

References

• Ref 1: miR-3656 expression enhances the chemosensitivity of pancreatic cancer to gemcitabine through modulation of the RHOF/EMT axis. Cell Death Dis. 2017 Oct 19;8(10):e3129. doi: 10.1038/cddis.2017.530.