General Information of the Molecule (ID: Mol01543)
Name
hsa-mir-3656 ,Homo sapiens
Synonyms
microRNA 3656
    Click to Show/Hide
Molecule Type
Precursor miRNA
Sequence
CUUUCGGCCAGCGGGACGGCAUCCGAGGUGGGCUAGGCUCGGGCCCGUGGCGGGUGCGGG
GGUGGGAGG
    Click to Show/Hide
HGNC ID
HGNC:38889
Precursor Accession
MI0016056
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [1]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Epithelial mesenchymal transition signaling pathway Activation hsa01521
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
Capan-2 cells Pancreas Homo sapiens (Human) CVCL_0026
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
HPDE6-C7 cells Pancreas Homo sapiens (Human) CVCL_0P38
HTERT-HPNE cells Pancreas Homo sapiens (Human) CVCL_C466
PATU8988 cells Pancreas Homo sapiens (Human) CVCL_1846
CFPAC1 cells Pancreas Homo sapiens (Human) CVCL_1119
HPAC cells Pancreas Homo sapiens (Human) CVCL_3517
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description miR3656 expression enhances the chemosensitivity of pancreatic cancer to gemcitabine through modulation of the RHOF/EMT axis. miR3656 could target RHOF, a member of the Rho subfamily of small GTPases, and regulate the EMT process, enforced EMT progression via TWIST1 overexpression compromised the chemotherapy-enhancing effects of miR3656. Reduced miR3656 expression levels activated the EMT pathway through upregulation of RHOF, eventually causing drug resistance.
References
Ref 1 miR-3656 expression enhances the chemosensitivity of pancreatic cancer to gemcitabine through modulation of the RHOF/EMT axis. Cell Death Dis. 2017 Oct 19;8(10):e3129. doi: 10.1038/cddis.2017.530.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.