Molecule Information
General Information of the Molecule (ID: Mol01539)
| Name |
hsa-mir-939
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 939
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR939
|
||||
| Gene ID | |||||
| Location |
chr8:144394149-144394230[-]
|
||||
| Sequence |
UGUGGGCAGGGCCCUGGGGAGCUGAGGCUCUGGGGGUGGCCGGGGCUGACCCUGGGCCUC
UGCUCCCCAGUGUCUGACCGCG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| RAF/MEK/ERK signaling pathway | Inhibition | hsa04010 | ||
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay; Flow cytometric analysis; Wound-healing, migration and invasion assay | |||
| Mechanism Description | Decreased expression of miR939 contributes to chemoresistance and metastasis of gastric cancer via dysregulation of SLC34A2 and Raf/MEk/ERk pathway. miR939 exerted its function mainly through inhibiting SLC34A2/Raf/MEk/ERk pathway, which is activated in GC. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
