Molecule Information
General Information of the Molecule (ID: Mol01539)
Name |
hsa-mir-939
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 939
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR939
|
||||
Gene ID | |||||
Location |
chr8:144394149-144394230[-]
|
||||
Sequence |
UGUGGGCAGGGCCCUGGGGAGCUGAGGCUCUGGGGGUGGCCGGGGCUGACCCUGGGCCUC
UGCUCCCCAGUGUCUGACCGCG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
RAF/MEK/ERK signaling pathway | Inhibition | hsa04010 | ||
In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Colony formation assay; Flow cytometric analysis; Wound-healing, migration and invasion assay | |||
Mechanism Description | Decreased expression of miR939 contributes to chemoresistance and metastasis of gastric cancer via dysregulation of SLC34A2 and Raf/MEk/ERk pathway. miR939 exerted its function mainly through inhibiting SLC34A2/Raf/MEk/ERk pathway, which is activated in GC. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.