Molecule Information
General Information of the Molecule (ID: Mol01534)
| Name |
hsa-mir-874
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 874
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR874
|
||||
| Gene ID | |||||
| Location |
chr5:137647572-137647649[-]
|
||||
| Sequence |
UUAGCCCUGCGGCCCCACGCACCAGGGUAAGAGAGACUCUCGCUUCCUGCCCUGGCCCGA
GGGACCGACUGGCUGGGC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| BGC823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR 874 could inhibit autophagy and sensitize GC cells to chemotherapy via the target gene ATG16L1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [2] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| NCM460 cells | Colon | Homo sapiens (Human) | CVCL_0460 | |
| SW1116 cells | Colon | Homo sapiens (Human) | CVCL_0544 | |
| HCT-116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-874 inhibits growth, increases apoptosis and enhances chemosensitivity in CRC cells by targeting XIAP. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
