Molecule Information

General Information of the Molecule (ID: Mol01532)

• Name: hsa-mir-770 ,Homo sapiens
• Synonyms: microRNA 770
• Molecule Type: Precursor miRNA
• Gene Name: MIR770
• Gene ID: 768222
• Location: chr14:100852390-100852487[+]
• Sequence:
  AGGAGCCACCUUCCGAGCCUCCAGUACCACGUGUCAGGGCCACAUGAGCUGGGCCUCGUG
  GGCCUGAUGUGGUGCUGGGGCCUCAGGGGUCUGCUCUU
• Ensembl ID: ENSG00000211574
• HGNC ID: HGNC:33143
• Precursor Accession: MI0005118

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR770, a potential tumor suppressor, could specifically target and down-regulate STMN1, thus inhibit the metastasis and chemo-resistance of TNBC cells.

References

• Ref 1: MiR-770 suppresses the chemo-resistance and metastasis of triple negative breast cancer via direct targeting of STMN1. Cell Death Dis. 2018 Jan 11;9(1):14. doi: 10.1038/s41419-017-0030-7.