Molecule Information

General Information of the Molecule (ID: Mol01528)

Name	hsa-mir-663 ,Homo sapiens
Synonyms	microRNA 663a Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR663A
Gene ID	724033
Location	chr20:26208186-26208278[-]
Sequence	CCUUCCGGCGUCCCAGGCGGGGCGCCGCGGGACCGCCCUCGUGUCUGUGGCGGUGGGAUC CCGCGGCCGUGUUUUCCUGGUGGCCCGGCCAUG Click to Show/Hide
Ensembl ID	ENSG00000284419
HGNC ID	HGNC:32919
Precursor Accession	MI0003672
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cyclophosphamide

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[1]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Cyclophosphamide			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MDA-MB-231 cells	Breast	Homo sapiens (Human)	CVCL_0062
	BT474 cells	Breast	Homo sapiens (Human)	CVCL_0179
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	TUNEL analysis
Mechanism Description	Overexpression of hypomethylated miR-663 induced chemoresistance in breast cancer cells by down-regulating HSPG2.

Docetaxel

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[1]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Docetaxel			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MDA-MB-231 cells	Breast	Homo sapiens (Human)	CVCL_0062
	BT474 cells	Breast	Homo sapiens (Human)	CVCL_0179
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	TUNEL analysis
Mechanism Description	Overexpression of hypomethylated miR-663 induced chemoresistance in breast cancer cells by down-regulating HSPG2.

References

Ref 1	The overexpression of hypomethylated miR-663 induces chemotherapy resistance in human breast cancer cells by targeting heparin sulfate proteoglycan 2 (HSPG2). J Biol Chem. 2013 Apr 19;288(16):10973-85. doi: 10.1074/jbc.M112.434340. Epub 2013 Feb 22.