Molecule Information
General Information of the Molecule (ID: Mol01528)
Name |
hsa-mir-663
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 663a
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR663A
|
||||
Gene ID | |||||
Location |
chr20:26208186-26208278[-]
|
||||
Sequence |
CCUUCCGGCGUCCCAGGCGGGGCGCCGCGGGACCGCCCUCGUGUCUGUGGCGGUGGGAUC
CCGCGGCCGUGUUUUCCUGGUGGCCCGGCCAUG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Cyclophosphamide | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
BT474 cells | Breast | Homo sapiens (Human) | CVCL_0179 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
TUNEL analysis | |||
Mechanism Description | Overexpression of hypomethylated miR-663 induced chemoresistance in breast cancer cells by down-regulating HSPG2. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Docetaxel | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
BT474 cells | Breast | Homo sapiens (Human) | CVCL_0179 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
TUNEL analysis | |||
Mechanism Description | Overexpression of hypomethylated miR-663 induced chemoresistance in breast cancer cells by down-regulating HSPG2. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.