Molecule Information

General Information of the Molecule (ID: Mol01525)

• Name: hsa-mir-548b ,Homo sapiens
• Synonyms: microRNA 548b
• Molecule Type: Precursor miRNA
• Gene Name: MIR548B
• Gene ID: 693128
• Location: chr6:119069047-119069143[-]
• Sequence:
  CAGACUAUAUAUUUAGGUUGGCGCAAAAGUAAUUGUGGUUUUGGCCUUUAUUUUCAAUGG
  CAAGAACCUCAGUUGCUUUUGUGCCAACCUAAUACUU
• Ensembl ID: ENSG00000207982
• HGNC ID: HGNC:32799
• Precursor Accession: MI0003596

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: Calu1 cells; Lung; Homo sapiens (Human); CVCL_0608
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: miR-374a and miR-548b modulated by Axl have essential roles in cell cycle arrest, gefitinib-induced apoptosis, epithelial-to-mesenchymal transition, migration and tumorigenesis of gefitinib-resistant lung cancer cells in vitro and in vivo by targeting Wnt5a and CCNB1 genes, respectively. Of clinical significance, high expression of Axl and miR-374a and low expression of miR-548b are associated with poor disease-free survival postoperatively. These findings indicate that the modulation of specific miRNAs may provide a therapeutic target to treat or reverse gefitinib resistance in NSCLC with high expression of Axl in the future. Overexpression of Wnt5a in HCC827-Gef cells partially restored the cell sensitivity to gefitinib (Wnt5a in HCC827-Gef cells partially restored the cell sensitivity to gefitinib.

References

• Ref 1: Axl-altered microRNAs regulate tumorigenicity and gefitinib resistance in lung cancer. Cell Death Dis. 2014 May 15;5(5):e1227. doi: 10.1038/cddis.2014.186.