Molecule Information

General Information of the Molecule (ID: Mol01524)

• Name: hsa-mir-574 ,Homo sapiens
• Synonyms: microRNA 574
• Molecule Type: Precursor miRNA
• Gene Name: MIR574
• Gene ID: 693159
• Location: chr4:38868032-38868127[+]
• Sequence:
  GGGACCUGCGUGGGUGCGGGCGUGUGAGUGUGUGUGUGUGAGUGUGUGUCGCUCCGGGUC
  CACGCUCAUGCACACACCCACACGCCCACACUCAGG
• Ensembl ID: ENSG00000207944
• HGNC ID: HGNC:32830
• Precursor Accession: MI0003581

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: microRNA-574 enhances doxorubicin resistance through down-regulating SMAD4 in breast cancer cells.

References

• Ref 1: MicroRNA-574 enhances doxorubicin resistance through down-regulating SMAD4 in breast cancer cells. Eur Rev Med Pharmacol Sci. 2018 Mar;22(5):1342-1350. doi: 10.26355/eurrev_201803_14476.