Molecule Information

General Information of the Molecule (ID: Mol01523)

• Name: hsa-mir-551b ,Homo sapiens
• Synonyms: microRNA 551b
• Molecule Type: Precursor miRNA
• Gene Name: MIR551B
• Gene ID: 693136
• Location: chr3:168551854-168551949[+]
• Sequence:
  AGAUGUGCUCUCCUGGCCCAUGAAAUCAAGCGUGGGUGAGACCUGGUGCAGAACGGGAAG
  GCGACCCAUACUUGGUUUCAGAGGCUGUGAGAAUAA
• Ensembl ID: ENSG00000207717
• HGNC ID: HGNC:32807
• Precursor Accession: MI0003575

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: 8910 cells; Ovary; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay; Soft agar colony formation assay
• Mechanism Description: Down-regulation of Foxo3 and TRIM31 by miR551b in side population promotes cell proliferation, invasion, and drug resistance of ovarian cancer.

References

• Ref 1: Downregulation of Foxo3 and TRIM31 by miR-551b in side population promotes cell proliferation, invasion, and drug resistance of ovarian cancer. Med Oncol. 2016 Nov;33(11):126. doi: 10.1007/s12032-016-0842-9. Epub 2016 Oct 14.