Molecule Information
General Information of the Molecule (ID: Mol01523)
Name |
hsa-mir-551b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 551b
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR551B
|
||||
Gene ID | |||||
Location |
chr3:168551854-168551949[+]
|
||||
Sequence |
AGAUGUGCUCUCCUGGCCCAUGAAAUCAAGCGUGGGUGAGACCUGGUGCAGAACGGGAAG
GCGACCCAUACUUGGUUUCAGAGGCUGUGAGAAUAA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
8910 cells | Ovary | Homo sapiens (Human) | N.A. | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Soft agar colony formation assay | |||
Mechanism Description | Down-regulation of Foxo3 and TRIM31 by miR551b in side population promotes cell proliferation, invasion, and drug resistance of ovarian cancer. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.