Molecule Information
General Information of the Molecule (ID: Mol01522)
| Name |
hsa-mir-92b
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 92b
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR92B
|
||||
| Gene ID | |||||
| Location |
chr1:155195177-155195272[+]
|
||||
| Sequence |
CGGGCCCCGGGCGGGCGGGAGGGACGGGACGCGGUGCAGUGUUGUUUUUUCCCCCGCCAA
UAUUGCACUCGUCCCGGCCUCCGGCCCCCCCGGCCC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of miR-92b promotes, while knockdown of it inhabits A549 cell growth, miR-92b regulates the resistance of NSCLC A549 cells to CDDP, Anti-miR-92b sensitizes A549/CDDP cells to CDDP-induced apop-tosis, miR-92b down-regulates PTEN expression at mRNA and protein level in A549 cells, PTEN plays important roles in cell cycle detention and apoptosis, regulation of cell adherence, migration, differentiation and has the function of enhancing the sensitivity of cancer cells to certain anticancer agents. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
