Molecule Information

General Information of the Molecule (ID: Mol01522)

• Name: hsa-mir-92b ,Homo sapiens
• Synonyms: microRNA 92b
• Molecule Type: Precursor miRNA
• Gene Name: MIR92B
• Gene ID: 693235
• Location: chr1:155195177-155195272[+]
• Sequence:
  CGGGCCCCGGGCGGGCGGGAGGGACGGGACGCGGUGCAGUGUUGUUUUUUCCCCCGCCAA
  UAUUGCACUCGUCCCGGCCUCCGGCCCCCCCGGCCC
• Ensembl ID: ENSG00000284586
• HGNC ID: HGNC:32920
• Precursor Accession: MI0003560

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-92b promotes, while knockdown of it inhabits A549 cell growth, miR-92b regulates the resistance of NSCLC A549 cells to CDDP, Anti-miR-92b sensitizes A549/CDDP cells to CDDP-induced apop-tosis, miR-92b down-regulates PTEN expression at mRNA and protein level in A549 cells, PTEN plays important roles in cell cycle detention and apoptosis, regulation of cell adherence, migration, differentiation and has the function of enhancing the sensitivity of cancer cells to certain anticancer agents.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [3]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Differential gene expression between parental and gemcitabine-resistant pancreatic cancer cell. Consequently, compared with SW1990 cells, 28 microRNAs were upregulated and 28 microRNAs were decreased (fold change>=2) in SW1990/GEM cells. Then, the expression of some differential microRNAs was confirmed by Q-PCR assays. We found that miR-643, miR-1261, miR483-5p, miR-371a-5p, and miR-373-3p were upregulated and that the expression of miR-4455, miR-3676, miR-4650, miR4791, and miR-4644 was decreased in SW1990/GEM cells. Generally, the tendency of expression changes was consistent between microRNA-seq and Q-PCR results.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical carcinoma [ICD-11: 2C77.0] [4]

• Resistant Disease: Cervical carcinoma [ICD-11: 2C77.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: Caski cells; Uterus; Homo sapiens (Human); CVCL_1100
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: APE1's endonuclease activity, via association with the DROSHA-processing complex, is necessary for processing mature miR-92b, thereby regulating expression of miR-92b's direct target LDLR. The miR-92b promotes cell proliferation in vitro and in vivo, promotes cell-cycle progression, and reduces apoptosis and chemosensitivity. LDLR silencing recapitulated miR-92b's transformative effects, while LDLR overexpression rescued these effects.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: MiR-92b regulates the cell growth, cisplatin chemosensitivity of A549 non small cell lung cancer cell line and target PTEN. Biochem Biophys Res Commun. 2013 Nov 1;440(4):604-10. doi: 10.1016/j.bbrc.2013.09.111. Epub 2013 Oct 4.
• Ref 3: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 4: Alterations in p53 predict response to preoperative high dose chemotherapy in patients with gastric cancerMol Pathol. 2003 Oct;56(5):286-92. doi: 10.1136/mp.56.5.286.