Molecule Information

General Information of the Molecule (ID: Mol01522)

• Name: hsa-mir-92b ,Homo sapiens
• Synonyms: microRNA 92b
• Molecule Type: Precursor miRNA
• Gene Name: MIR92B
• Gene ID: 693235
• Location: chr1:155195177-155195272[+]
• Sequence:
  CGGGCCCCGGGCGGGCGGGAGGGACGGGACGCGGUGCAGUGUUGUUUUUUCCCCCGCCAA
  UAUUGCACUCGUCCCGGCCUCCGGCCCCCCCGGCCC
• Ensembl ID: ENSG00000284586
• HGNC ID: HGNC:32920
• Precursor Accession: MI0003560

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-92b promotes, while knockdown of it inhabits A549 cell growth, miR-92b regulates the resistance of NSCLC A549 cells to CDDP, Anti-miR-92b sensitizes A549/CDDP cells to CDDP-induced apop-tosis, miR-92b down-regulates PTEN expression at mRNA and protein level in A549 cells, PTEN plays important roles in cell cycle detention and apoptosis, regulation of cell adherence, migration, differentiation and has the function of enhancing the sensitivity of cancer cells to certain anticancer agents.

References

• Ref 1: MiR-92b regulates the cell growth, cisplatin chemosensitivity of A549 non small cell lung cancer cell line and target PTEN. Biochem Biophys Res Commun. 2013 Nov 1;440(4):604-10. doi: 10.1016/j.bbrc.2013.09.111. Epub 2013 Oct 4.