Molecule Information

General Information of the Molecule (ID: Mol01521)

• Name: hsa-mir-487b ,Homo sapiens
• Synonyms: microRNA 487b
• Molecule Type: Precursor miRNA
• Gene Name: MIR487B
• Gene ID: 664616
• Location: chr14:101046455-101046538[+]
• Sequence:
  UUGGUACUUGGAGAGUGGUUAUCCCUGUCCUGUUCGUUUUGCUCAUGUCGAAUCGUACAG
  GGUCAUCCACUUUUUCAGUAUCAA
• Ensembl ID: ENSG00000207754
• HGNC ID: HGNC:32533
• Precursor Accession: MI0003530

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [1]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: PC-14 cells; Lung; Homo sapiens (Human); CVCL_1640
• In Vitro Model: LC-2/ad cells; Lung; Homo sapiens (Human); CVCL_1373
• In Vitro Model: RERF-LCkJ cells; Lung; Homo sapiens (Human); CVCL_1654
• In Vitro Model: ABC-1 cells; Lung; Homo sapiens (Human); CVCL_1066
• In Vitro Model: RERF-LCMS cells; Lung; Homo sapiens (Human); CVCL_1655
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-134/487b/655 cluster contributed to the TGF-beta1-induced EMT phenomenon and affected the resistance to gefitinib by directly targeting MAGI2, in which suppression subsequently caused loss of PTEN stability in lung cancer cells.

References

• Ref 1: MiR-134/487b/655 cluster regulates TGF-Beta-induced epithelial-mesenchymal transition and drug resistance to gefitinib by targeting MAGI2 in lung adenocarcinoma cells. Mol Cancer Ther. 2014 Feb;13(2):444-53. doi: 10.1158/1535-7163.MCT-13-0448. Epub 2013 Nov 20.