Molecule Information

General Information of the Molecule (ID: Mol01514)

• Name: hsa-mir-522 ,Homo sapiens
• Synonyms: microRNA 522
• Molecule Type: Precursor miRNA
• Gene Name: MIR522
• Gene ID: 574495
• Location: chr19:53751211-53751297[+]
• Sequence:
  UCUCAGGCUGUGUCCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAAUGG
  UUCCCUUUAGAGUGUUACGCUUUGAGA
• Ensembl ID: ENSG00000283685
• HGNC ID: HGNC:32127
• Precursor Accession: MI0003177

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Testicular cancer [.] [1]

• Resistant Disease: Testicular cancer [.]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-qPCR with "Low Density Array"
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Examining almost all known human micro-RNA species confirmed the miR-371-373 cluster as a promising target for explaining cisplatin resistance, potentially by counteracting wild-type P53 induced senescence or linking it with the potency to differentiate. Moreover, we describe for the first time an association of the up-regulation of micro-RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [2]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: When miR 522 was overexpressed in the HT29/DOX cells, the protein expression levels of ABCB5 were downregulated. Furthermore, knockdown of ABCB5 significantly increased the growth inhibition rate of the HT29/DOX cells, compared with the control group. These results suggested that miR 522 may affect the sensitivity of colon cancer cell lines to DOX treatment by targeting ABCB5.

References

• Ref 1: Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30(1):55. doi: 10.1186/1756-9966-30-55.
• Ref 2: MicroRNA-522 reverses drug resistance of doxorubicin-induced HT29 colon cancer cell by targeting ABCB5. Mol Med Rep. 2015 Sep;12(3):3930-3936. doi: 10.3892/mmr.2015.3890. Epub 2015 Jun 4.
• Ref 3: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.