Molecule Information
General Information of the Molecule (ID: Mol01514)
| Name |
hsa-mir-522
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 522
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR522
|
||||
| Gene ID | |||||
| Location |
chr19:53751211-53751297[+]
|
||||
| Sequence |
UCUCAGGCUGUGUCCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAAUGG
UUCCCUUUAGAGUGUUACGCUUUGAGA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Testicular cancer [.] | [1] | |||
| Resistant Disease | Testicular cancer [.] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
RT-qPCR with "Low Density Array" | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Examining almost all known human micro-RNA species confirmed the miR-371-373 cluster as a promising target for explaining cisplatin resistance, potentially by counteracting wild-type P53 induced senescence or linking it with the potency to differentiate. Moreover, we describe for the first time an association of the up-regulation of micro-RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [2] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | When miR 522 was overexpressed in the HT29/DOX cells, the protein expression levels of ABCB5 were downregulated. Furthermore, knockdown of ABCB5 significantly increased the growth inhibition rate of the HT29/DOX cells, compared with the control group. These results suggested that miR 522 may affect the sensitivity of colon cancer cell lines to DOX treatment by targeting ABCB5. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
