Molecule Information
General Information of the Molecule (ID: Mol01514)
Name |
hsa-mir-522
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 522
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR522
|
||||
Gene ID | |||||
Location |
chr19:53751211-53751297[+]
|
||||
Sequence |
UCUCAGGCUGUGUCCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAAUGG
UUCCCUUUAGAGUGUUACGCUUUGAGA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colon cancer | [1] | |||
Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | When miR 522 was overexpressed in the HT29/DOX cells, the protein expression levels of ABCB5 were downregulated. Furthermore, knockdown of ABCB5 significantly increased the growth inhibition rate of the HT29/DOX cells, compared with the control group. These results suggested that miR 522 may affect the sensitivity of colon cancer cell lines to DOX treatment by targeting ABCB5. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.