Molecule Information

General Information of the Molecule (ID: Mol01514)

Name	hsa-mir-522 ,Homo sapiens
Synonyms	microRNA 522 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR522
Gene ID	574495
Location	chr19:53751211-53751297[+]
Sequence	UCUCAGGCUGUGUCCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAAUGG UUCCCUUUAGAGUGUUACGCUUUGAGA Click to Show/Hide
Ensembl ID	ENSG00000283685
HGNC ID	HGNC:32127
Precursor Accession	MI0003177
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Doxorubicin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1]				[1]
Sensitive Disease	Colon cancer [ICD-11: 2B90.1]			Disease Info
Sensitive Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell proliferation		Inhibition	hsa05200
In Vitro Model	HT29 Cells	Colon	Homo sapiens (Human)	CVCL_A8EZ
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	MTT assay; Flow cytometry assay
Mechanism Description	When miR 522 was overexpressed in the HT29/DOX cells, the protein expression levels of ABCB5 were downregulated. Furthermore, knockdown of ABCB5 significantly increased the growth inhibition rate of the HT29/DOX cells, compared with the control group. These results suggested that miR 522 may affect the sensitivity of colon cancer cell lines to DOX treatment by targeting ABCB5.

References

Ref 1	MicroRNA-522 reverses drug resistance of doxorubicin-induced HT29 colon cancer cell by targeting ABCB5. Mol Med Rep. 2015 Sep;12(3):3930-3936. doi: 10.3892/mmr.2015.3890. Epub 2015 Jun 4.