Molecule Information
General Information of the Molecule (ID: Mol01513)
| Name |
hsa-mir-520g
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 520g
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR520G
|
||||
| Gene ID | |||||
| Location |
chr19:53722166-53722255[+]
|
||||
| Sequence |
UCCCAUGCUGUGACCCUCUAGAGGAAGCACUUUCUGUUUGUUGUCUGAGAAAAAACAAAG
UGCUUCCCUUUAGAGUGUUACCGUUUGGGA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] | [1] | |||
| Resistant Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell proliferation | Activation | hsa05200 | ||
| MAPK/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| CAOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0201 | |
| OVCA433 cells | Ovary | Homo sapiens (Human) | CVCL_0475 | |
| OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
| ES-2 cells | Ovary | Homo sapiens (Human) | CVCL_3509 | |
| MCAS cells | Ovary | Homo sapiens (Human) | CVCL_3020 | |
| OVk18 cells | Ovary | Homo sapiens (Human) | CVCL_3770 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-520g expression is significantly increased in EOC and high miR-520g expression promotes tumor development, increases chemoresistance to platinum-based chemotherapy and reduces patient survival. miR-520g directly targets and downregulates DAPk2 by binding the DAPk2 3'UTR. DAPk2 suppression, followed by MAPk and AkT pathway activation, promotes the biological processes mediated by miR-520g in EOC. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [2] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [3] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| p53/miR520g/p21 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
| FET cells | Colon | Homo sapiens (Human) | CVCL_A604 | |
| GEO cells | Colon | Homo sapiens (Human) | CVCL_0271 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay; ELISA assay | |||
| Mechanism Description | p53 suppresses miR-520g expression and that deletion of p53 up-regulates miR-520g expression. Inhibition of miR-520g in p53 / cells increased their sensitivity to 5-FU treatment. miR-520g conferred resistance to 5-FU-induced apoptosis through the inhibition of p21 expression, which is a direct target of miR-520g. Rescued expression of p21 in miR-520g-expressing colon cancer cells sensitized them to 5-FU-induced apoptosis. Importantly, experiments in tumor xenograft mouse models demonstrate that miR-520g reduced the effectiveness of 5-FU in the inhibition of tumor growth in vivo. Moreover, studies of colorectal cancer specimens indicate a positive correlation between miR-520g expression and chemoresistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [3] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| p53/miR520g/p21 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
| FET cells | Colon | Homo sapiens (Human) | CVCL_A604 | |
| GEO cells | Colon | Homo sapiens (Human) | CVCL_0271 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay; ELISA assay | |||
| Mechanism Description | p53 suppresses miR-520g expression and that deletion of p53 up-regulates miR-520g expression. Inhibition of miR-520g in p53 / cells increased their sensitivity to 5-FU treatment. miR-520g conferred resistance to 5-FU-induced apoptosis through the inhibition of p21 expression, which is a direct target of miR-520g. Rescued expression of p21 in miR-520g-expressing colon cancer cells sensitized them to 5-FU-induced apoptosis. Importantly, experiments in tumor xenograft mouse models demonstrate that miR-520g reduced the effectiveness of 5-FU in the inhibition of tumor growth in vivo. Moreover, studies of colorectal cancer specimens indicate a positive correlation between miR-520g expression and chemoresistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] | [1] | |||
| Resistant Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell proliferation | Activation | hsa05200 | ||
| MAPK/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| CAOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0201 | |
| OVCA433 cells | Ovary | Homo sapiens (Human) | CVCL_0475 | |
| OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
| ES-2 cells | Ovary | Homo sapiens (Human) | CVCL_3509 | |
| MCAS cells | Ovary | Homo sapiens (Human) | CVCL_3020 | |
| OVk18 cells | Ovary | Homo sapiens (Human) | CVCL_3770 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-520g expression is significantly increased in EOC and high miR-520g expression promotes tumor development, increases chemoresistance to platinum-based chemotherapy and reduces patient survival. miR-520g directly targets and downregulates DAPk2 by binding the DAPk2 3'UTR. DAPk2 suppression, followed by MAPk and AkT pathway activation, promotes the biological processes mediated by miR-520g in EOC. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [2] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Verapamil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
