Molecule Information

General Information of the Molecule (ID: Mol01513)

• Name: hsa-mir-520g ,Homo sapiens
• Synonyms: microRNA 520g
• Molecule Type: Precursor miRNA
• Gene Name: MIR520G
• Gene ID: 574484
• Location: chr19:53722166-53722255[+]
• Sequence:
  UCCCAUGCUGUGACCCUCUAGAGGAAGCACUUUCUGUUUGUUGUCUGAGAAAAAACAAAG
  UGCUUCCCUUUAGAGUGUUACCGUUUGGGA
• Ensembl ID: ENSG00000207799
• HGNC ID: HGNC:32116
• Precursor Accession: MI0003166

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [1]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: MAPK/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: ES-2 cells; Ovary; Homo sapiens (Human); CVCL_3509
• In Vitro Model: MCAS cells; Ovary; Homo sapiens (Human); CVCL_3020
• In Vitro Model: OVk18 cells; Ovary; Homo sapiens (Human); CVCL_3770
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-520g expression is significantly increased in EOC and high miR-520g expression promotes tumor development, increases chemoresistance to platinum-based chemotherapy and reduces patient survival. miR-520g directly targets and downregulates DAPk2 by binding the DAPk2 3'UTR. DAPk2 suppression, followed by MAPk and AkT pathway activation, promotes the biological processes mediated by miR-520g in EOC.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [3]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: p53/miR520g/p21 signaling pathway; Regulation; N.A.
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: FET cells; Colon; Homo sapiens (Human); CVCL_A604
• In Vitro Model: GEO cells; Colon; Homo sapiens (Human); CVCL_0271
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; ELISA assay
• Mechanism Description: p53 suppresses miR-520g expression and that deletion of p53 up-regulates miR-520g expression. Inhibition of miR-520g in p53 / cells increased their sensitivity to 5-FU treatment. miR-520g conferred resistance to 5-FU-induced apoptosis through the inhibition of p21 expression, which is a direct target of miR-520g. Rescued expression of p21 in miR-520g-expressing colon cancer cells sensitized them to 5-FU-induced apoptosis. Importantly, experiments in tumor xenograft mouse models demonstrate that miR-520g reduced the effectiveness of 5-FU in the inhibition of tumor growth in vivo. Moreover, studies of colorectal cancer specimens indicate a positive correlation between miR-520g expression and chemoresistance.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [3]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: p53/miR520g/p21 signaling pathway; Regulation; N.A.
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: FET cells; Colon; Homo sapiens (Human); CVCL_A604
• In Vitro Model: GEO cells; Colon; Homo sapiens (Human); CVCL_0271
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; ELISA assay
• Mechanism Description: p53 suppresses miR-520g expression and that deletion of p53 up-regulates miR-520g expression. Inhibition of miR-520g in p53 / cells increased their sensitivity to 5-FU treatment. miR-520g conferred resistance to 5-FU-induced apoptosis through the inhibition of p21 expression, which is a direct target of miR-520g. Rescued expression of p21 in miR-520g-expressing colon cancer cells sensitized them to 5-FU-induced apoptosis. Importantly, experiments in tumor xenograft mouse models demonstrate that miR-520g reduced the effectiveness of 5-FU in the inhibition of tumor growth in vivo. Moreover, studies of colorectal cancer specimens indicate a positive correlation between miR-520g expression and chemoresistance.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [1]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: MAPK/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: ES-2 cells; Ovary; Homo sapiens (Human); CVCL_3509
• In Vitro Model: MCAS cells; Ovary; Homo sapiens (Human); CVCL_3020
• In Vitro Model: OVk18 cells; Ovary; Homo sapiens (Human); CVCL_3770
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-520g expression is significantly increased in EOC and high miR-520g expression promotes tumor development, increases chemoresistance to platinum-based chemotherapy and reduces patient survival. miR-520g directly targets and downregulates DAPk2 by binding the DAPk2 3'UTR. DAPk2 suppression, followed by MAPk and AkT pathway activation, promotes the biological processes mediated by miR-520g in EOC.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: MicroRNA-520g promotes epithelial ovarian cancer progression and chemoresistance via DAPK2 repression. Oncotarget. 2016 May 3;7(18):26516-34. doi: 10.18632/oncotarget.8530.
• Ref 2: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 3: MicroRNA-520g confers drug resistance by regulating p21 expression in colorectal cancer. J Biol Chem. 2015 Mar 6;290(10):6215-25. doi: 10.1074/jbc.M114.620252. Epub 2015 Jan 23.