Molecule Information

General Information of the Molecule (ID: Mol01500)

Name	hsa-mir-487a ,Homo sapiens
Synonyms	microRNA 487a Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR487A
Gene ID	619555
Location	chr14:101052446-101052525[+]
Sequence	GGUACUUGAAGAGUGGUUAUCCCUGCUGUGUUCGCUUAAUUUAUGACGAAUCAUACAGGG ACAUCCAGUUUUUCAGUAUC Click to Show/Hide
Ensembl ID	ENSG00000207742
HGNC ID	HGNC:32343
Precursor Accession	MI0002471
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[1]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
Experiment for Drug Resistance	CellTiter-Blue Cell Viability Assay (Promega)
Mechanism Description	Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Mitoxantrone

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3]				[2]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Mitoxantrone			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell survival		Activation	hsa05200
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
In Vivo Model	BALB/c nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	Ectopic miR-487a down-regulated BCRP expression at the mRNA and protein levels, increasing the intracellular accumulation and cytotoxicity of Mitoxantrone in resistant MCF-7/MX breast cancer cells.

References

Ref 1	Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
Ref 2	MiR-487a resensitizes mitoxantrone (MX)-resistant breast cancer cells (MCF-7/MX) to MX by targeting breast cancer resistance protein (BCRP/ABCG2). Cancer Lett. 2013 Oct 1;339(1):107-15. doi: 10.1016/j.canlet.2013.07.016. Epub 2013 Jul 20.