Molecule Information

General Information of the Molecule (ID: Mol01499)

Name	hsa-mir-483 ,Homo sapiens
Synonyms	microRNA 483 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR483
Gene ID	619552
Location	chr11:2134134-2134209[-]
Sequence	GAGGGGGAAGACGGGAGGAAAGAAGGGAGUGGUUCCAUCACGCCUCCUCACUCCUCUCCU CCCGUCUUCUCCUCUC Click to Show/Hide
Ensembl ID	ENSG00000207805
HGNC ID	HGNC:32340
Precursor Accession	MI0002467
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]				[1]
Resistant Disease	Esophageal squamous cell carcinoma [ICD-11: 2B70.3]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
In Vitro Model	ECA-109 cells	Esophagus	Homo sapiens (Human)	CVCL_6898
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	High expression of miR-483 and miR-214 might predict less chemotherapy effect. Down-regulation of miR-483 and miR-214 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs to esophageal cancer cells, and it might induce increased accumulation of adriamycin (ADR) and decreased amount of ADR released.

References

Ref 1	Prediction value of miR-483 and miR-214 in prognosis and multidrug resistance of esophageal squamous cell carcinoma. Genet Test Mol Biomarkers. 2013 Jun;17(6):470-4. doi: 10.1089/gtmb.2012.0518. Epub 2013 May 13.