Molecule Information

General Information of the Molecule (ID: Mol01498)

Name	hsa-mir-410 ,Homo sapiens
Synonyms	microRNA 410 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR410
Gene ID	574434
Location	chr14:101065912-101065991[+]
Sequence	GGUACCUGAGAAGAGGUUGUCUGUGAUGAGUUCGCUUUUAUUAAUGACGAAUAUAACACA GAUGGCCUGUUUUCAGUACC Click to Show/Hide
Ensembl ID	ENSG00000199092
HGNC ID	HGNC:32065
Precursor Accession	MI0002465
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

4 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Sensitive Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	HEK293T cells	Kidney	Homo sapiens (Human)	CVCL_0063
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	U2OS cells	Bone	Homo sapiens (Human)	CVCL_0042
	HFob 1.19	Bone	Homo sapiens (Human)	CVCL_3708
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region.

Doxorubicin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Sensitive Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Sensitive Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	HEK293T cells	Kidney	Homo sapiens (Human)	CVCL_0063
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	U2OS cells	Bone	Homo sapiens (Human)	CVCL_0042
	HFob 1.19	Bone	Homo sapiens (Human)	CVCL_3708
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region.

Sirolimus

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Sensitive Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Sensitive Drug	Sirolimus			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	HEK293T cells	Kidney	Homo sapiens (Human)	CVCL_0063
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	U2OS cells	Bone	Homo sapiens (Human)	CVCL_0042
	HFob 1.19	Bone	Homo sapiens (Human)	CVCL_3708
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region.

Verapamil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[2]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Verapamil			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	MiRNA microarray; RT-PCR; Western blot
Experiment for Drug Resistance	MTT assay
Mechanism Description	MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

Ref 1	MicroRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma. Mol Med Rep. 2017 Mar;15(3):1326-1334. doi: 10.3892/mmr.2017.6149. Epub 2017 Jan 26.
Ref 2	The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.