Molecule Information
General Information of the Molecule (ID: Mol01498)
| Name |
hsa-mir-410
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 410
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR410
|
||||
| Gene ID | |||||
| Location |
chr14:101065912-101065991[+]
|
||||
| Sequence |
GGUACCUGAGAAGAGGUUGUCUGUGAUGAGUUCGCUUUUAUUAAUGACGAAUAUAACACA
GAUGGCCUGUUUUCAGUACC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 |
| MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| HFob 1.19 | Bone | Homo sapiens (Human) | CVCL_3708 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 |
| MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| HFob 1.19 | Bone | Homo sapiens (Human) | CVCL_3708 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Sirolimus | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 |
| MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| HFob 1.19 | Bone | Homo sapiens (Human) | CVCL_3708 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
