Molecule Information

General Information of the Molecule (ID: Mol01498)

• Name: hsa-mir-410 ,Homo sapiens
• Synonyms: microRNA 410
• Molecule Type: Precursor miRNA
• Gene Name: MIR410
• Gene ID: 574434
• Location: chr14:101065912-101065991[+]
• Sequence:
  GGUACCUGAGAAGAGGUUGUCUGUGAUGAGUUCGCUUUUAUUAAUGACGAAUAUAACACA
  GAUGGCCUGUUUUCAGUACC
• Ensembl ID: ENSG00000199092
• HGNC ID: HGNC:32065
• Precursor Accession: MI0002465

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: HFob 1.19; Bone; Homo sapiens (Human); CVCL_3708
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: HFob 1.19; Bone; Homo sapiens (Human); CVCL_3708
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region.

Sirolimus

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Sirolimus
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: HFob 1.19; Bone; Homo sapiens (Human); CVCL_3708
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region.

References

• Ref 1: MicroRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma. Mol Med Rep. 2017 Mar;15(3):1326-1334. doi: 10.3892/mmr.2017.6149. Epub 2017 Jan 26.