General Information of the Molecule (ID: Mol01488)
Name
hsa-mir-135b ,Homo sapiens
Synonyms
microRNA 135b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR135B
Gene ID
442891
Location
chr1:205448302-205448398[-]
Sequence
CACUCUGCUGUGGCCUAUGGCUUUUCAUUCCUAUGUGAUUGCUGUCCCAAACUCAUGUAG
GGCUAAAAGCCAUGGGCUACAGUGAGGGGCGAGCUCC
    Click to Show/Hide
Ensembl ID
ENSG00000199059
HGNC ID
HGNC:31760
Precursor Accession
MI0000810
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/DDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Annexin V-FITC and PI apoptosis detection assay
Mechanism Description miR135b reverses chemoresistance of non-small cell lung cancer cells by downregulation of FZD1.
Disease Class: Lung cancer [2]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Hsa-miR-135a/b could play a role in the development of CDDP resistance in lung cancer cell line at least in partby modulation of apoptosis via targeting MCL1.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [3]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PI3K/AKT signaling pathway Activation hsa04151
In Vitro Model HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
LOVO cells Colon Homo sapiens (Human) CVCL_0399
HCT-8/5-FU cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Upregulation of microRNA-135b and microRNA-182 promotes chemoresistance of colorectal cancer by targeting ST6GALNAC2 via PI3k/AkT pathway. Inhibition of the PI3k/AkT pathway enhanced the chemosensitivity to 5-FU in HCT-8/5-FU and LoVo/5-FU.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [4]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
FOXO1 signaling pathway Activation hsa04068
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Knockdown of Mir-135b Sensitizes Colorectal Cancer Cells to Oxaliplatin-Induced Apoptosis Through Increase of FOXO1.
References
Ref 1 miR-135b reverses chemoresistance of non-small cell lung cancer cells by downregulation of FZD1. Biomed Pharmacother. 2016 Dec;84:123-129. doi: 10.1016/j.biopha.2016.09.027. Epub 2016 Sep 16.
Ref 2 miR-135a/b modulate cisplatin resistance of human lung cancer cell line by targeting MCL1. Pathol Oncol Res. 2013 Oct;19(4):677-83. doi: 10.1007/s12253-013-9630-4. Epub 2013 May 3.
Ref 3 Upregulation of microRNA-135b and microRNA-182 promotes chemoresistance of colorectal cancer by targeting ST6GALNAC2 via PI3K/AKT pathway. Mol Carcinog. 2017 Dec;56(12):2669-2680. doi: 10.1002/mc.22710. Epub 2017 Aug 21.
Ref 4 Knockdown of Mir-135b Sensitizes Colorectal Cancer Cells to Oxaliplatin-Induced Apoptosis Through Increase of FOXO1. Cell Physiol Biochem. 2018;48(4):1628-1637. doi: 10.1159/000492284. Epub 2018 Aug 2.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.