Molecule Information
General Information of the Molecule (ID: Mol01488)
Name |
hsa-mir-135b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 135b
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR135B
|
||||
Gene ID | |||||
Location |
chr1:205448302-205448398[-]
|
||||
Sequence |
CACUCUGCUGUGGCCUAUGGCUUUUCAUUCCUAUGUGAUUGCUGUCCCAAACUCAUGUAG
GGCUAAAAGCCAUGGGCUACAGUGAGGGGCGAGCUCC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
A549/DDP cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Annexin V-FITC and PI apoptosis detection assay | |||
Mechanism Description | miR135b reverses chemoresistance of non-small cell lung cancer cells by downregulation of FZD1. | |||
Disease Class: Lung cancer | [2] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
A549/CDDP cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Hsa-miR-135a/b could play a role in the development of CDDP resistance in lung cancer cell line at least in partby modulation of apoptosis via targeting MCL1. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [3] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
PI3K/AKT signaling pathway | Activation | hsa04151 | ||
In Vitro Model | HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 |
LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
HCT-8/5-FU cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Upregulation of microRNA-135b and microRNA-182 promotes chemoresistance of colorectal cancer by targeting ST6GALNAC2 via PI3k/AkT pathway. Inhibition of the PI3k/AkT pathway enhanced the chemosensitivity to 5-FU in HCT-8/5-FU and LoVo/5-FU. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [4] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
FOXO1 signaling pathway | Activation | hsa04068 | ||
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Knockdown of Mir-135b Sensitizes Colorectal Cancer Cells to Oxaliplatin-Induced Apoptosis Through Increase of FOXO1. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.