Molecule Information

General Information of the Molecule (ID: Mol01488)

• Name: hsa-mir-135b ,Homo sapiens
• Synonyms: microRNA 135b
• Molecule Type: Precursor miRNA
• Gene Name: MIR135B
• Gene ID: 442891
• Location: chr1:205448302-205448398[-]
• Sequence:
  CACUCUGCUGUGGCCUAUGGCUUUUCAUUCCUAUGUGAUUGCUGUCCCAAACUCAUGUAG
  GGCUAAAAGCCAUGGGCUACAGUGAGGGGCGAGCUCC
• Ensembl ID: ENSG00000199059
• HGNC ID: HGNC:31760
• Precursor Accession: MI0000810

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Annexin V-FITC and PI apoptosis detection assay
• Mechanism Description: miR135b reverses chemoresistance of non-small cell lung cancer cells by downregulation of FZD1.

Disease Class: Lung cancer [2]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/CDDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Hsa-miR-135a/b could play a role in the development of CDDP resistance in lung cancer cell line at least in partby modulation of apoptosis via targeting MCL1.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [3]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: HCT-8/5-FU cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Upregulation of microRNA-135b and microRNA-182 promotes chemoresistance of colorectal cancer by targeting ST6GALNAC2 via PI3k/AkT pathway. Inhibition of the PI3k/AkT pathway enhanced the chemosensitivity to 5-FU in HCT-8/5-FU and LoVo/5-FU.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [4]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: FOXO1 signaling pathway; Activation; hsa04068
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Knockdown of Mir-135b Sensitizes Colorectal Cancer Cells to Oxaliplatin-Induced Apoptosis Through Increase of FOXO1.

References

• Ref 1: miR-135b reverses chemoresistance of non-small cell lung cancer cells by downregulation of FZD1. Biomed Pharmacother. 2016 Dec;84:123-129. doi: 10.1016/j.biopha.2016.09.027. Epub 2016 Sep 16.
• Ref 2: miR-135a/b modulate cisplatin resistance of human lung cancer cell line by targeting MCL1. Pathol Oncol Res. 2013 Oct;19(4):677-83. doi: 10.1007/s12253-013-9630-4. Epub 2013 May 3.
• Ref 3: Upregulation of microRNA-135b and microRNA-182 promotes chemoresistance of colorectal cancer by targeting ST6GALNAC2 via PI3K/AKT pathway. Mol Carcinog. 2017 Dec;56(12):2669-2680. doi: 10.1002/mc.22710. Epub 2017 Aug 21.
• Ref 4: Knockdown of Mir-135b Sensitizes Colorectal Cancer Cells to Oxaliplatin-Induced Apoptosis Through Increase of FOXO1. Cell Physiol Biochem. 2018;48(4):1628-1637. doi: 10.1159/000492284. Epub 2018 Aug 2.