Molecule Information
General Information of the Molecule (ID: Mol01483)
Name |
hsa-mir-330
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 330
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR330
|
||||
Gene ID | |||||
Location |
chr19:45638994-45639087[-]
|
||||
Sequence |
CUUUGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGCAAGAUCAACCGAGCAA
AGCACACGGCCUGCAGAGAGGCAGCGCUCUGCCC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colon cancer | [1] | |||
Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 |
Colo320 cells | Colon | Homo sapiens (Human) | CVCL_1989 | |
WiDR cells | Colon | Homo sapiens (Human) | CVCL_2760 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Sulforhodamide B (SRB) test assay | |||
Mechanism Description | Deoxycytidine kinase (dCk) is essential for phosphorylation of natural deoxynucleosides andanalogs, such as gemcitabine and cytarabine, two widely used anticancer compounds. miR-330 expression negatively correlated withdCk mRNA expression, suggesting a role of miR-330 in post-transcriptional regulationof dCk. Expression of miR-330 in various colon and lung cancer cell lines,as measured by QRT-PCR, varied five-fold between samples and correlated with in-vitro gemcitabineresistance. | |||
Disease Class: Lung cancer | [1] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
SW1573 cells | Lung | Homo sapiens (Human) | CVCL_1720 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Sulforhodamide B (SRB) test assay | |||
Mechanism Description | Deoxycytidine kinase (dCk) is essential for phosphorylation of natural deoxynucleosides andanalogs, such as gemcitabine and cytarabine, two widely used anticancer compounds. miR-330 expression negatively correlated withdCk mRNA expression, suggesting a role of miR-330 in post-transcriptional regulationof dCk. Expression of miR-330 in various colon and lung cancer cell lines,as measured by QRT-PCR, varied five-fold between samples and correlated with in-vitro gemcitabineresistance. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.