Molecule Information
General Information of the Molecule (ID: Mol01483)
| Name |
hsa-mir-330
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 330
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR330
|
||||
| Gene ID | |||||
| Location |
chr19:45638994-45639087[-]
|
||||
| Sequence |
CUUUGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGCAAGAUCAACCGAGCAA
AGCACACGGCCUGCAGAGAGGCAGCGCUCUGCCC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [1] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 |
| Colo320 cells | Colon | Homo sapiens (Human) | CVCL_1989 | |
| WiDR cells | Colon | Homo sapiens (Human) | CVCL_2760 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Sulforhodamide B (SRB) test assay | |||
| Mechanism Description | Deoxycytidine kinase (dCk) is essential for phosphorylation of natural deoxynucleosides andanalogs, such as gemcitabine and cytarabine, two widely used anticancer compounds. miR-330 expression negatively correlated withdCk mRNA expression, suggesting a role of miR-330 in post-transcriptional regulationof dCk. Expression of miR-330 in various colon and lung cancer cell lines,as measured by QRT-PCR, varied five-fold between samples and correlated with in-vitro gemcitabineresistance. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [1] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| SW1573 cells | Lung | Homo sapiens (Human) | CVCL_1720 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Sulforhodamide B (SRB) test assay | |||
| Mechanism Description | Deoxycytidine kinase (dCk) is essential for phosphorylation of natural deoxynucleosides andanalogs, such as gemcitabine and cytarabine, two widely used anticancer compounds. miR-330 expression negatively correlated withdCk mRNA expression, suggesting a role of miR-330 in post-transcriptional regulationof dCk. Expression of miR-330 in various colon and lung cancer cell lines,as measured by QRT-PCR, varied five-fold between samples and correlated with in-vitro gemcitabineresistance. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
