General Information of the Molecule (ID: Mol01483)
Name
hsa-mir-330 ,Homo sapiens
Synonyms
microRNA 330
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR330
Gene ID
442902
Location
chr19:45638994-45639087[-]
Sequence
CUUUGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGCAAGAUCAACCGAGCAA
AGCACACGGCCUGCAGAGAGGCAGCGCUCUGCCC
    Click to Show/Hide
Ensembl ID
ENSG00000284544
HGNC ID
HGNC:31771
Precursor Accession
MI0000803
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [1]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HT-29 cells Colon Homo sapiens (Human) CVCL_0320
Colo320 cells Colon Homo sapiens (Human) CVCL_1989
WiDR cells Colon Homo sapiens (Human) CVCL_2760
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Sulforhodamide B (SRB) test assay
Mechanism Description Deoxycytidine kinase (dCk) is essential for phosphorylation of natural deoxynucleosides andanalogs, such as gemcitabine and cytarabine, two widely used anticancer compounds. miR-330 expression negatively correlated withdCk mRNA expression, suggesting a role of miR-330 in post-transcriptional regulationof dCk. Expression of miR-330 in various colon and lung cancer cell lines,as measured by QRT-PCR, varied five-fold between samples and correlated with in-vitro gemcitabineresistance.
Disease Class: Lung cancer [ICD-11: 2C25.5] [1]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
SW1573 cells Lung Homo sapiens (Human) CVCL_1720
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Sulforhodamide B (SRB) test assay
Mechanism Description Deoxycytidine kinase (dCk) is essential for phosphorylation of natural deoxynucleosides andanalogs, such as gemcitabine and cytarabine, two widely used anticancer compounds. miR-330 expression negatively correlated withdCk mRNA expression, suggesting a role of miR-330 in post-transcriptional regulationof dCk. Expression of miR-330 in various colon and lung cancer cell lines,as measured by QRT-PCR, varied five-fold between samples and correlated with in-vitro gemcitabineresistance.
References
Ref 1 Regulation of deoxycytidine kinase expression and sensitivity to gemcitabine by micro-RNA 330 and promoter methylation in cancer cells. Nucleosides Nucleotides Nucleic Acids. 2011 Dec;30(12):1214-22. doi: 10.1080/15257770.2011.629271.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.