Molecule Information

General Information of the Molecule (ID: Mol01483)

• Name: hsa-mir-330 ,Homo sapiens
• Synonyms: microRNA 330
• Molecule Type: Precursor miRNA
• Gene Name: MIR330
• Gene ID: 442902
• Location: chr19:45638994-45639087[-]
• Sequence:
  CUUUGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGCAAGAUCAACCGAGCAA
  AGCACACGGCCUGCAGAGAGGCAGCGCUCUGCCC
• Ensembl ID: ENSG00000284544
• HGNC ID: HGNC:31771
• Precursor Accession: MI0000803

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [1]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: Colo320 cells; Colon; Homo sapiens (Human); CVCL_1989
• In Vitro Model: WiDR cells; Colon; Homo sapiens (Human); CVCL_2760
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Sulforhodamide B (SRB) test assay
• Mechanism Description: Deoxycytidine kinase (dCk) is essential for phosphorylation of natural deoxynucleosides andanalogs, such as gemcitabine and cytarabine, two widely used anticancer compounds. miR-330 expression negatively correlated withdCk mRNA expression, suggesting a role of miR-330 in post-transcriptional regulationof dCk. Expression of miR-330 in various colon and lung cancer cell lines,as measured by QRT-PCR, varied five-fold between samples and correlated with in-vitro gemcitabineresistance.

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: SW1573 cells; Lung; Homo sapiens (Human); CVCL_1720
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Sulforhodamide B (SRB) test assay
• Mechanism Description: Deoxycytidine kinase (dCk) is essential for phosphorylation of natural deoxynucleosides andanalogs, such as gemcitabine and cytarabine, two widely used anticancer compounds. miR-330 expression negatively correlated withdCk mRNA expression, suggesting a role of miR-330 in post-transcriptional regulationof dCk. Expression of miR-330 in various colon and lung cancer cell lines,as measured by QRT-PCR, varied five-fold between samples and correlated with in-vitro gemcitabineresistance.

References

• Ref 1: Regulation of deoxycytidine kinase expression and sensitivity to gemcitabine by micro-RNA 330 and promoter methylation in cancer cells. Nucleosides Nucleotides Nucleic Acids. 2011 Dec;30(12):1214-22. doi: 10.1080/15257770.2011.629271.