General Information of the Molecule (ID: Mol01473)
Name
hsa-mir-374a ,Homo sapiens
Synonyms
microRNA 374a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR374A
Gene ID
442919
Location
chrX:74287286-74287357[-]
Sequence
UACAUCGGCCAUUAUAAUACAACCUGAUAAGUGUUAUAGCACUUAUCAGAUUGUAUUGUA
AUUGUCUGUGUA
    Click to Show/Hide
Ensembl ID
ENSG00000199168
HGNC ID
HGNC:31788
Precursor Accession
MI0000782
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CellTiter 96 aqueous one solution cell proliferation assay
Mechanism Description miR-130a and miR-374a mimics decreased the sensitivity of A2780 cells to cisplatin, reversely, their inhibitors could resensitize A2780/DDP cells. Furthermore, overexpression of miR-130a could increase the MDR1 mRNA and P-gp levels in A2780 and A2780/DDP cells, whereas knockdown of miR-130a could inhibit MDR1 gene expression and upregulate the PTEN protein expression. In a conclusion, the deregulation of miR-374a and miR-130a may be involved in the development and regulation of cisplatin resistance in ovarian cancer cells. This role of miR-130a may be achieved by regulating the MDR1 and PTEN gene expression.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [2]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
Experiment for
Drug Resistance
CellTiter-Blue Cell Viability Assay (Promega)
Mechanism Description Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [3]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model HCC827 cells Lung Homo sapiens (Human) CVCL_2063
Calu1 cells Lung Homo sapiens (Human) CVCL_0608
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTS assay; Flow cytometry assay
Mechanism Description miR-374a and miR-548b modulated by Axl have essential roles in cell cycle arrest, gefitinib-induced apoptosis, epithelial-to-mesenchymal transition, migration and tumorigenesis of gefitinib-resistant lung cancer cells in vitro and in vivo by targeting Wnt5a and CCNB1 genes, respectively. Of clinical significance, high expression of Axl and miR-374a and low expression of miR-548b are associated with poor disease-free survival postoperatively. These findings indicate that the modulation of specific miRNAs may provide a therapeutic target to treat or reverse gefitinib resistance in NSCLC with high expression of Axl in the future. Overexpression of Wnt5a in HCC827-Gef cells partially restored the cell sensitivity to gefitinib (Wnt5a in HCC827-Gef cells partially restored the cell sensitivity to gefitinib.
Paclitaxel
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant glioma [ICD-11: 2A00.02] [4]
Sensitive Disease Malignant glioma [ICD-11: 2A00.02]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model IGROV1 cells Ovary Homo sapiens (Human) CVCL_1304
MCAS cells Ovary Homo sapiens (Human) CVCL_3020
OVCA429 cells Ovary Homo sapiens (Human) CVCL_3936
OVCA432 cells Ovary Homo sapiens (Human) CVCL_3769
OVCA433 cells Ovary Homo sapiens (Human) CVCL_0475
PEO1 cells Ovary Homo sapiens (Human) CVCL_2686
PEO4 cells Ovary Homo sapiens (Human) CVCL_2690
TOV-112D cells Ovary Homo sapiens (Human) CVCL_3612
TOV21G cells Ovary Homo sapiens (Human) CVCL_3613
OVCAR10 cells Ovary Homo sapiens (Human) CVCL_4377
OVCAR8 cells Ovary Homo sapiens (Human) CVCL_1629
OVCAR5 cells Ovary Homo sapiens (Human) CVCL_1628
OVCAR4 cells Ovary Homo sapiens (Human) CVCL_1627
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Based on miRNA expression and GI50 data, Pearson's correlation test identified 35 miRNAs associated with in vitro paclitaxel sensitivity (P<0.05).
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [5]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
LCC9 cells Breast Homo sapiens (Human) CVCL_DP52
Experiment for
Molecule Alteration
Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.
References
Ref 1 MiR-130a and MiR-374a Function as Novel Regulators of Cisplatin Resistance in Human Ovarian Cancer A2780 Cells. PLoS One. 2015 Jun 4;10(6):e0128886. doi: 10.1371/journal.pone.0128886. eCollection 2015.
Ref 2 Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
Ref 3 Axl-altered microRNAs regulate tumorigenicity and gefitinib resistance in lung cancer. Cell Death Dis. 2014 May 15;5(5):e1227. doi: 10.1038/cddis.2014.186.
Ref 4 The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
Ref 5 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.