Molecule Information

General Information of the Molecule (ID: Mol01472)

• Name: hsa-mir-370 ,Homo sapiens
• Synonyms: microRNA 370
• Molecule Type: Precursor miRNA
• Gene Name: MIR370
• Gene ID: 442915
• Location: chr14:100911139-100911213[+]
• Sequence:
  AGACAGAGAAGCCAGGUCACGUCUCUGCAGUUACACAGCUCACGAGUGCCUGCUGGGGUG
  GAACCUGGUCUGUCU
• Ensembl ID: ENSG00000199005
• HGNC ID: HGNC:31784
• Precursor Accession: MI0000778

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Endometrioid ovarian cancer [ICD-11: 2C73.5] [2]

• Sensitive Disease: Endometrioid ovarian cancer [ICD-11: 2C73.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HEY cells; Ovary; Homo sapiens (Human); CVCL_0297
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: UWB1.289 cells; Ovary; Homo sapiens (Human); CVCL_B079
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: ES-2 cells; Ovary; Homo sapiens (Human); CVCL_3509
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: TOV112D cells; Ovary; Homo sapiens (Human); CVCL_3612
• In Vitro Model: TOV21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• Experiment for Molecule Alteration: qRT-PCR; Northern blot analysis
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: microRNA-370 (miR-370) was down-regulated in endometrioid ovarian cancer cells. In IGROV1 and TOV112D endometrioid ovarian cancer cells, miR-370 suppressed cellular viability and colony formation. miR-370 also (+) endometrioid ovarian cancer cell chemosensitivity to cDDP. Endoglin (ENG) was directly and negatively regulated by miR-370.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760).

Omacetaxine mepesuccinate

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [4]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Omacetaxine mepesuccinate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR370/FoxM1 signaling pathway; Regulation; N.A.
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-370 sensitized k562 cells to HHT by inducing apoptosis in part by downregulation of FoxM1 expression.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [5]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Primary central nervous system lymphoma [ICD-11: 2A8Z.0] [6]

• Sensitive Disease: Primary central nervous system lymphoma [ICD-11: 2A8Z.0]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Raji Burkitt cells; Bone; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: Western blot analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Our study described a new miR-370-mediated mechanism of MGMT regulation in PCNSL. We first showed that miR-370 was downregulated in PCNSL tissues, while MGMT was inversely overexpressed. It was also observed that miR-370 suppressed the expression of MGMT. Additionally, upregulation of miR-370 significantly increased TMZ sensitivity dependent of MGMT, thus suppressed Raji cell proliferation and induced apoptosis in vitro. These results suggest that miR-370 is a potential target in PCNSL treatment.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [7]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: MicroRNA-370 suppresses proliferation and promotes endometrioid ovarian cancer chemosensitivity to cDDP by negatively regulating ENG. Cancer Lett. 2014 Oct 28;353(2):201-10. doi: 10.1016/j.canlet.2014.07.026. Epub 2014 Jul 22.
• Ref 3: miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
• Ref 4: MiR-370 sensitizes chronic myeloid leukemia K562 cells to homoharringtonine by targeting Forkhead box M1. J Transl Med. 2013 Oct 23;11:265. doi: 10.1186/1479-5876-11-265.
• Ref 5: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 6: miR-370 Sensitizes TMZ Response Dependent of MGMT Status in Primary Central Nervous System Lymphoma .Pathol Oncol Res. 2020 Apr;26(2):707-714. doi: 10.1007/s12253-019-00605-4. Epub 2019 Feb 2. 10.1007/s12253-019-00605-4
• Ref 7: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.