Molecule Information

General Information of the Molecule (ID: Mol01471)

• Name: hsa-mir-376c ,Homo sapiens
• Synonyms: microRNA 376c
• Molecule Type: Precursor miRNA
• Gene Name: MIR376C
• Gene ID: 442913
• Location: chr14:101039690-101039755[+]
• Sequence:
  AAAAGGUGGAUAUUCCUUCUAUGUUUAUGUUAUUUAUGGUUAAACAUAGAGGAAAUUCCA
  CGUUUU
• Ensembl ID: ENSG00000283279
• HGNC ID: HGNC:31782
• Precursor Accession: MI0000776

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Nodal/ALK7 signaling pathway; Inhibition; hsa04350
• Cell Pathway Regulation: Spheroid formation; Activation; hsa04140
• In Vitro Model: A2780s cells; Ovary; Homo sapiens (Human); CVCL_4863
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: We found that miR-376c increased cell proliferation and survival, as well as spheroid formation, in part by targeting ALk7. We have also provided evidence that the Nodal-ALk7 pathway is involved in cisplatin-induced ovarian cancer cell death and that miR-376c might promote chemoresistance.

References

• Ref 1: MicroRNA 376c enhances ovarian cancer cell survival by targeting activin receptor-like kinase 7: implications for chemoresistance. J Cell Sci. 2011 Feb 1;124(Pt 3):359-68. doi: 10.1242/jcs.072223. Epub 2011 Jan 11.