Molecule Information
General Information of the Molecule (ID: Mol01471)
Name |
hsa-mir-376c
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 376c
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR376C
|
||||
Gene ID | |||||
Location |
chr14:101039690-101039755[+]
|
||||
Sequence |
AAAAGGUGGAUAUUCCUUCUAUGUUUAUGUUAUUUAUGGUUAAACAUAGAGGAAAUUCCA
CGUUUU Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
Nodal/ALK7 signaling pathway | Inhibition | hsa04350 | ||
Spheroid formation | Activation | hsa04140 | ||
In Vitro Model | A2780s cells | Ovary | Homo sapiens (Human) | CVCL_4863 |
OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
WST-1 assay | |||
Mechanism Description | We found that miR-376c increased cell proliferation and survival, as well as spheroid formation, in part by targeting ALk7. We have also provided evidence that the Nodal-ALk7 pathway is involved in cisplatin-induced ovarian cancer cell death and that miR-376c might promote chemoresistance. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.