Molecule Information
General Information of the Molecule (ID: Mol01471)
| Name |
hsa-mir-376c
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 376c
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR376C
|
||||
| Gene ID | |||||
| Location |
chr14:101039690-101039755[+]
|
||||
| Sequence |
AAAAGGUGGAUAUUCCUUCUAUGUUUAUGUUAUUUAUGGUUAAACAUAGAGGAAAUUCCA
CGUUUU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [1] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| Nodal/ALK7 signaling pathway | Inhibition | hsa04350 | ||
| Spheroid formation | Activation | hsa04140 | ||
| In Vitro Model | A2780s cells | Ovary | Homo sapiens (Human) | CVCL_4863 |
| OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | We found that miR-376c increased cell proliferation and survival, as well as spheroid formation, in part by targeting ALk7. We have also provided evidence that the Nodal-ALk7 pathway is involved in cisplatin-induced ovarian cancer cell death and that miR-376c might promote chemoresistance. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
