Molecule Information

General Information of the Molecule (ID: Mol01469)

• Name: hsa-mir-302c ,Homo sapiens
• Synonyms: microRNA 302c
• Molecule Type: Precursor miRNA
• Gene Name: MIR302C
• Gene ID: 442895
• Location: chr4:112648363-112648430[-]
• Sequence:
  CCUUUGCUUUAACAUGGGGGUACCUGCUGUGUGAAACAAAAGUAAGUGCUUCCAUGUUUC
  AGUGGAGG
• Ensembl ID: ENSG00000199102
• HGNC ID: HGNC:31764
• Precursor Accession: MI0000773

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: ERK signaling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: MAP/ERk kinase kinase 1 (MEkk1) as a direct and functional target of miR-302. miR-302 showed combinatorial effects on MkEE1 repression and MEkk1-mediated ERk pathway. The suppression of P-gp by miR-302 was reversed by MEkk1 overexpression. miR-302 cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein by targeting MEkk1 of ERk pathway.

Mitoxantrone

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Mitoxantrone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-302 inhibits BCRP expression via targeting the 3'-UTR of BCRP mRNA. miR-302 members may cooperatively downregulate BCRP expression to increase chemosensitivity of breast cancer cells. miR-302 gene cluster may be a potential target for reversing BCRP-mediated chemoresistance in breast cancer.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res. 2016 Feb 3;35:25. doi: 10.1186/s13046-016-0300-8.
• Ref 2: miR-302a/b/c/d cooperatively inhibit BCRP expression to increase drug sensitivity in breast cancer cells. Gynecol Oncol. 2016 Jun;141(3):592-601. doi: 10.1016/j.ygyno.2015.11.034. Epub 2015 Nov 28.
• Ref 3: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.