Molecule Information
General Information of the Molecule (ID: Mol01468)
| Name |
hsa-mir-302b
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 302b
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR302B
|
||||
| Gene ID | |||||
| Location |
chr4:112648485-112648557[-]
|
||||
| Sequence |
GCUCCCUUCAACUUUAACAUGGAAGUGCUUUCUGUGACUUUAAAAGUAAGUGCUUCCAUG
UUUUAGUAGGAGU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay; Trypan blue stain assay | |||
| Mechanism Description | miR-302b overexpression enhances sensitivity to cisplatin in breast cancer cell lines, reducing cell viability and proliferation in response to the treatment. We also identified E2F1, a master regulator of the G1/S transition, as a direct target gene of miR-302b. E2F1 transcriptionally activates ATM, the main cellular sensor of DNA damage. Through the negative regulation of E2F1, miR-302b indirectly affects ATM expression, abrogating cell-cycle progression upon cisplatin treatment. Moreover miR-302b, impairs the ability of breast cancer cells to repair damaged DNA, enhancing apoptosis activation following cisplatin treatment. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| ERK signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | MAP/ERk kinase kinase 1 (MEkk1) as a direct and functional target of miR-302. miR-302 showed combinatorial effects on MkEE1 repression and MEkk1-mediated ERk pathway. The suppression of P-gp by miR-302 was reversed by MEkk1 overexpression. miR-302 cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein by targeting MEkk1 of ERk pathway. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Mitoxantrone | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | miR-302 inhibits BCRP expression via targeting the 3'-UTR of BCRP mRNA. miR-302 members may cooperatively downregulate BCRP expression to increase chemosensitivity of breast cancer cells. miR-302 gene cluster may be a potential target for reversing BCRP-mediated chemoresistance in breast cancer. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
