Molecule Information

General Information of the Molecule (ID: Mol01467)

• Name: hsa-mir-365 ,Homo sapiens
• Synonyms: microRNA 365a
• Molecule Type: Precursor miRNA
• Gene Name: MIR365A
• Gene ID: 100126355
• Location: chr16:14309285-14309371[+]
• Sequence:
  ACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUCCACUAUCAUAAUG
  CCCCUAAAAAUCCUUAUUGCUCUUGCA
• Ensembl ID: ENSG00000199130
• HGNC ID: HGNC:33692
• Precursor Accession: MI0000767

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [1]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-365 directly targets the pro-apoptotic molecules SHC1 and BAX, whose reductions contribute to gemcitabine resistance in pancreatic cancer cells.

References

• Ref 1: MiR-365 induces gemcitabine resistance in pancreatic cancer cells by targeting the adaptor protein SHC1 and pro-apoptotic regulator BAX. Cell Signal. 2014 Feb;26(2):179-85. doi: 10.1016/j.cellsig.2013.11.003. Epub 2013 Nov 9.