Molecule Information

General Information of the Molecule (ID: Mol01464)

• Name: hsa-mir-30e ,Homo sapiens
• Synonyms: microRNA 30e
• Molecule Type: Precursor miRNA
• Gene Name: MIR30E
• Gene ID: 407034
• Location: chr1:40754355-40754446[+]
• Sequence:
  GGGCAGUCUUUGCUACUGUAAACAUCCUUGACUGGAAGCUGUAAGGUGUUCAGAGGAGCU
  UUCAGUCGGAUGUUUACAGCGGCAGGCUGCCA
• Ensembl ID: ENSG00000198974
• HGNC ID: HGNC:31629
• Precursor Accession: MI0000749

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: HCC827/GR cells; Lung; Homo sapiens (Human); CVCL_V620
• In Vitro Model: PC9G cells; Lung; Homo sapiens (Human); CVCL_V337
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR30e overexpression inPC9G cells resulted in reduced cell proliferation and migration,reversing drug resistance to gefitinib, miR30e directly targeted HOXA1 in lung cancer cells.

Imatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [2]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: JAKT/STAT/PI3K/AKT signaling pathway; Inhibition; hsa04630
• In Vitro Model: THP-1 cells; Blood; Homo sapiens (Human); CVCL_0006
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: HEK293 cells; Kidney; Homo sapiens (Human); CVCL_0045
• In Vitro Model: Meg-01 cells; Blood; Homo sapiens (Human); CVCL_0425
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: Luciferase assay verified that miR-30e directly targets ABL. Enforced expression of miR-30e in k562 cells suppressed proliferation and induced apoptosis of these cells and sensitized them to imatinib treatment. These findings strongly suggest that miR-30e acts as a tumor suppressor by downregulating BCR-ABL expression.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/ERK signaling pathway; Inhibition; hsa04010
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Wound healing assay; Flow cytometry assay; Caspase-3 Activity Assay
• Mechanism Description: miR30e inhibits tumor growth and chemoresistance via targeting IRS1 in Breast Cancer, by targeting IRS1, miR30e is able to inhibit AkT and ERk1/2 pathways.

References

• Ref 1: MicroRNA-30e reduces cell growth and enhances drug sensitivity to gefitinib in lung carcinoma. Oncotarget. 2017 Jan 17;8(3):4572-4581. doi: 10.18632/oncotarget.13944.
• Ref 2: MiR-30e induces apoptosis and sensitizes K562 cells to imatinib treatment via regulation of the BCR-ABL protein. Cancer Lett. 2015 Jan 28;356(2 Pt B):597-605. doi: 10.1016/j.canlet.2014.10.006. Epub 2014 Oct 8.
• Ref 3: MiR-30e inhibits tumor growth and chemoresistance via targeting IRS1 in Breast Cancer. Sci Rep. 2017 Nov 21;7(1):15929. doi: 10.1038/s41598-017-16175-x.