Molecule Information

General Information of the Molecule (ID: Mol01438)

• Name: hsa-mir-127 ,Homo sapiens
• Synonyms: microRNA 127
• Molecule Type: Precursor miRNA
• Gene Name: MIR127
• Gene ID: 406914
• Location: chr14:100882979-100883075[+]
• Sequence:
  UGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGG
  AUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCAUCAUC
• Ensembl ID: ENSG00000207608
• HGNC ID: HGNC:31509
• Precursor Accession: MI0000472

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [1]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT signaling pathway; Inhibition; hsa04151
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87-MG cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: microRNA-127 silencing significantly affects cell growth and increases the sensitivity to adriamycin. microRNA-127 silencing arrests the cell cycle, potentiates adriamycin-induced apoptosis, and increases cellular Rh-123 uptake. microRNA-127 silencing down-regulates MDR1, MRP1, Runx2, Bcl-2, Survivin and ErbB4 expression while up-regulates p53 expression. microRNA-127 silencing inhibits AkT phosphorylation.

References

• Ref 1: Knockdown of microRNA-127 reverses adriamycin resistance via cell cycle arrest and apoptosis sensitization in adriamycin-resistant human glioma cells. Int J Clin Exp Pathol. 2015 Jun 1;8(6):6107-16. eCollection 2015.