Molecule Information
General Information of the Molecule (ID: Mol01438)
Name |
hsa-mir-127
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 127
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR127
|
||||
Gene ID | |||||
Location |
chr14:100882979-100883075[+]
|
||||
Sequence |
UGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGG
AUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCAUCAUC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioma | [1] | |||
Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | AKT signaling pathway | Inhibition | hsa04151 | |
Cell apoptosis | Activation | hsa04210 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
U87-MG cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay; Flow cytometry assay | |||
Mechanism Description | microRNA-127 silencing significantly affects cell growth and increases the sensitivity to adriamycin. microRNA-127 silencing arrests the cell cycle, potentiates adriamycin-induced apoptosis, and increases cellular Rh-123 uptake. microRNA-127 silencing down-regulates MDR1, MRP1, Runx2, Bcl-2, Survivin and ErbB4 expression while up-regulates p53 expression. microRNA-127 silencing inhibits AkT phosphorylation. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.