General Information of the Molecule (ID: Mol01433)
Name
hsa-mir-153 ,Homo sapiens
Synonyms
microRNA 153-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR153-1
Gene ID
406944
Location
chr2:219294111-219294200[-]
Sequence
CUCACAGCUGCCAGUGUCAUUUUUGUGAUCUGCAGCUAGUAUUCUCACUCCAGUUGCAUA
GUCACAAAAGUGAUCAUUGGCAGGUGUGGC
    Click to Show/Hide
Ensembl ID
ENSG00000207647
HGNC ID
HGNC:31539
Precursor Accession
MI0000463
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Arsenic trioxide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Leukemia [1]
Sensitive Disease Leukemia [ICD-11: 2B33.6]
Sensitive Drug Arsenic trioxide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Forced expression of miR-153 only in k562 cells has no significant effects on cell growth and apoptosis. However, when cells were additionally treated with As2O3, significant greater apoptosis was observed in the miR-153 overexpressed group.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [2]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
SW48 cells Colon Homo sapiens (Human) CVCL_1724
COLO205 cells Colon Homo sapiens (Human) CVCL_F402
In Vivo Model SCID nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay; Soft agar colony forming ability assay; Flow cytometry assay
Mechanism Description miR-153 promoted invasiveness indirectly by inducing MMP9 production, whereas drug resistance was mediated directly by inhibiting the Forkhead transcription factor FOXO3a.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [3]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
Capan-2 cells Pancreas Homo sapiens (Human) CVCL_0026
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
CFPAC1 cells Pancreas Homo sapiens (Human) CVCL_1119
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay; Annexin-V/PI Apoptosis assay; TUNEL assay
Mechanism Description miR153 enhanced gemcitabine sensitivity by targeting Snail in pancreatic cancer.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [2]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
SW48 cells Colon Homo sapiens (Human) CVCL_1724
COLO205 cells Colon Homo sapiens (Human) CVCL_F402
In Vivo Model SCID nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay; Soft agar colony forming ability assay; Flow cytometry assay
Mechanism Description miR-153 promoted invasiveness indirectly by inducing MMP9 production, whereas drug resistance was mediated directly by inhibiting the Forkhead transcription factor FOXO3a.
References
Ref 1 miR-153 sensitized the K562 cells to As2O3-induced apoptosis. Med Oncol. 2012 Mar;29(1):243-7. doi: 10.1007/s12032-010-9807-6. Epub 2011 Jan 26.
Ref 2 miR-153 supports colorectal cancer progression via pleiotropic effects that enhance invasion and chemotherapeutic resistance. Cancer Res. 2013 Nov 1;73(21):6435-47. doi: 10.1158/0008-5472.CAN-12-3308. Epub 2013 Aug 15.
Ref 3 miR-153 enhances the therapeutic effect of gemcitabine by targeting Snail in pancreatic cancer. Acta Biochim Biophys Sin (Shanghai). 2017 Jun 1;49(6):520-529. doi: 10.1093/abbs/gmx039.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.