Molecule Information
General Information of the Molecule (ID: Mol01420)
| Name |
hsa-mir-132
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 132
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR132
|
||||
| Gene ID | |||||
| Location |
chr17:2049908-2050008[-]
|
||||
| Sequence |
CCGCCCCCGCGUCUCCAGGGCAACCGUGGCUUUCGAUUGUUACUGUGGGAACUGGAGGUA
ACAGUCUACAGCCAUGGUCGCCCCGCAGCACGCCCACGCGC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | ABCG2 signaling pathway | Activation | hsa02010 | |
| SIRT1/CREB/ABCG2 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 |
| MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Upregulated miR132 in Lgr5+ gastric cancer stem cell-like cells contributes to cisplatin-resistance via SIRT1/CREB/ABCG2 signaling pathway. The expression of miR132 was inversely correlated with SIRT1 in gastric cancer specimens. Down-regulation of SIRT1 led to a subsequent increase of the level of acetylated CREB which in turn activated the ABCG2 signaling pathway. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | [2] | |||
| Sensitive Disease | Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | CNE2 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6889 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-132 can restore cisplatin treatment response in cisplatin-resistant xenografts in vivo, while FOXA1 protein levels were decreased. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell viability | Activation | hsa05200 | ||
| PTEN/AKT/NF-kappaB signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | AkT/NF-kB pathway contributes to the miR-132/-212-mediated drug resistance phenotype in breast cancer cells, which is likely regulated by suppressing PTEN expression at the molecular level. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [4] | |||
| Resistant Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | U87MG cells | Brain | Homo sapiens (Human) | CVCL_GP63 |
| U87MG-res cells | Brain | Homo sapiens (Human) | CVCL_GP63 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Soft agar assay; MTT assay; Sphere formation assay | |||
| Mechanism Description | microRNA-132 induces temozolomide resistance and promotes the formation of cancer stem cell phenotypes by targeting tumor suppressor candidate 3 in glioblastoma. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
