Molecule Information

General Information of the Molecule (ID: Mol01408)

• Name: hsa-let-7g ,Homo sapiens
• Synonyms: microRNA let-7g
• Molecule Type: Precursor miRNA
• Gene Name: MIRLET7G
• Gene ID: 406890
• Location: chr3:52268278-52268361[-]
• Sequence:
  AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUA
  ACUGUACAGGCCACUGCCUUGCCA
• Ensembl ID: ENSG00000199150
• HGNC ID: HGNC:31485
• Precursor Accession: MI0000433

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal carcinoma [ICD-11: 2B70.4] [1]

• Sensitive Disease: Esophageal carcinoma [ICD-11: 2B70.4]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: EC109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: HEEpiC cells; Esophagus; Homo sapiens (Human); N.A.
• In Vitro Model: TE10 cells; Esophagus; Homo sapiens (Human); CVCL_1760
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: ABCC10, a drug resistance gene, was identified as a functional and direct target gene of miR-let-7g/i. Luciferase reporter assay confirmed that let-7g and let-7i combined directly with 3'UTR of ABCC10, in consequence, inhibiting ABCC10 expression and enhancing cellular sensitivity to drugs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: RAS/RAF/MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [3]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell cycle; Inhibition; hsa04110
• In Vitro Model: Bel-7402/5-Fu cells; Liver; Homo sapiens (Human); CVCL_5493
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Let-7g microRNA contributed to an increase of 5-Fu-induced cell cycle inhibit in human hepatoma cell and sensitized cells to 5-Fu, leading to increased the effectiveness of the drug in treating hepatoma cancer.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: OVCAR8 cells; Ovary; Homo sapiens (Human); CVCL_1629
• In Vitro Model: LOX-IMVI cells; Ovary; Homo sapiens (Human); CVCL_1381
• In Vitro Model: NCI/ADR-RES cells; Ovary; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SRB cytotoxicity assay
• Mechanism Description: IMP-1 is an RNA binding protein that acts by stabilizing the mRNA of a number of target genes. In addition, IMP-1 was shown to protect the mRNA of MDR1 from endonucleolytic attack in an in vitro RNA stability assay. Introducing let-7g into ADR-RES cells expressing both IMP-1 and MDR1 reduced expression of both proteins rendering the cells more sensitive to treatment with either Taxol or vinblastine without affecting the sensitivity of the cells to carboplatin.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vinblastine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Vinblastine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: OVCAR8 cells; Ovary; Homo sapiens (Human); CVCL_1629
• In Vitro Model: LOX-IMVI cells; Ovary; Homo sapiens (Human); CVCL_1381
• In Vitro Model: NCI/ADR-RES cells; Ovary; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SRB cytotoxicity assay
• Mechanism Description: IMP-1 is an RNA binding protein that acts by stabilizing the mRNA of a number of target genes. In addition, IMP-1 was shown to protect the mRNA of MDR1 from endonucleolytic attack in an in vitro RNA stability assay. Introducing let-7g into ADR-RES cells expressing both IMP-1 and MDR1 reduced expression of both proteins rendering the cells more sensitive to treatment with either Taxol or vinblastine without affecting the sensitivity of the cells to carboplatin.

Clinical Trial Drug(s) 1 drug(s) in total

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [6]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

References

• Ref 1: BAG3-mediated miRNA let-7g and let-7i inhibit proliferation and enhance apoptosis of human esophageal carcinoma cells by targeting the drug transporter ABCC10. Cancer Lett. 2016 Feb 1;371(1):125-33. doi: 10.1016/j.canlet.2015.11.031. Epub 2015 Dec 3.
• Ref 2: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 3: Let-7 g microRNA sensitizes fluorouracil-resistant human hepatoma cells. Pharmazie. 2014 Apr;69(4):287-92.
• Ref 4: Let-7 modulates acquired resistance of ovarian cancer to Taxanes via IMP-1-mediated stabilization of multidrug resistance 1. Int J Cancer. 2012 Apr 15;130(8):1787-97. doi: 10.1002/ijc.26190. Epub 2011 Aug 16.
• Ref 5: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 6: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.