Molecule Information

General Information of the Molecule (ID: Mol01399)
Name
hsa-mir-216a ,Homo sapiens
Synonyms
microRNA 216a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR216A
Gene ID
406998
Location
chr2:55988950-55989059[-]
Sequence
GAUGGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUGUUCAUACAAUCCCUCA
CAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUAGCCCUCACGA
    Click to Show/Hide
Ensembl ID
ENSG00000207798
HGNC ID
HGNC:31593
Precursor Accession
MI0000292
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [2]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model 16HBE cells Lung Homo sapiens (Human) CVCL_0112
H446 cells Lung Homo sapiens (Human) CVCL_1562
H69 cells Lung Homo sapiens (Human) CVCL_8121
H69AR cells Lung Homo sapiens (Human) CVCL_3513
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell colony Activation hsa05200
Cell proliferation Activation hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OVCA433 cells Ovary Homo sapiens (Human) CVCL_0475
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-216a increases cisplatin resistance in ovarian cancer cells via downregulating PTEN.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [2]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model 16HBE cells Lung Homo sapiens (Human) CVCL_0112
H446 cells Lung Homo sapiens (Human) CVCL_1562
H69 cells Lung Homo sapiens (Human) CVCL_8121
H69AR cells Lung Homo sapiens (Human) CVCL_3513
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a. HOTTIP functioned as an oncogene in SCLC progression by binding miR216a and abrogating its tumor-suppressive function in this setting. HOTTIP also increased the expression of anti-apoptotic factor BCL-2, a target gene of miR216a, and jointly enhanced chemoresistance of SCLC by regulating BCL-2.
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [2]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Resistant Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model 16HBE cells Lung Homo sapiens (Human) CVCL_0112
H446 cells Lung Homo sapiens (Human) CVCL_1562
H69 cells Lung Homo sapiens (Human) CVCL_8121
H69AR cells Lung Homo sapiens (Human) CVCL_3513
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a.
Oxaliplatin
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0] [4]
Sensitive Disease Gastric cancer [ICD-11: 2B72.0]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MKN45 cells Liver Homo sapiens (Human) CVCL_0434
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Quantitative analyses revealed substantial downregulation of miR-216a-5p in both clinical GC samples and cellular models relative to matched non-neoplastic mucosal tissues and normal epithelial controls. Functional assays demonstrated that miR-216a-5p inhibited GC cell proliferation and migration while enhancing their sensitivity to OXA. Mechanistically, miR-216a-5p directly targeted and downregulated ZBTB2, thereby modulating GC cell growth and chemoresistance. Rescue experiments confirmed that ZBTB2 overexpression partially reversed the effects of miR-216a-5p on GC cells. In vivo studies further supported the tumour-suppressive role of miR-216a-5p and its regulation of ZBTB2.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [ICD-11: 2C12.6] [5]
Resistant Disease Liver cancer [ICD-11: 2C12.6]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PI3K/AKT signaling pathway Activation hsa04151
TGF-beta signaling pathway Activation hsa04350
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
HCCLM3 cells Liver Homo sapiens (Human) CVCL_6832
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
BEL-7404 cells Liver Homo sapiens (Human) CVCL_6568
PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
SNU449 cells Liver Homo sapiens (Human) CVCL_0454
Skhep1 cells Liver Homo sapiens (Human) CVCL_0525
HLE cells Liver Homo sapiens (Human) CVCL_1281
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description Overexpression of miR-216a/217 activates the PI3k/Akt and TGF-beta pathways by targeting PTEN and SMAD7, contributing to hepatocarcinogenesis, sorafenib resistance and tumor recurrence in HCC.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [6]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [7]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
A549 cells Lung Homo sapiens (Human) CVCL_0023
A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
Experiment for
Drug Resistance		 MTT assay; Apoptosis assay
Disease Class: Gastric cancer [ICD-11: 2B72.0] [7]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
A549 cells Lung Homo sapiens (Human) CVCL_0023
A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
Experiment for
Drug Resistance		 MTT assay; Apoptosis assay
References
Ref 1 The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
Ref 2 Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR-216a. Cell Death Dis. 2018 Jan 24;9(2):85. doi: 10.1038/s41419-017-0113-5.
Ref 3 STAT3 regulated miR-216a promotes ovarian cancer proliferation and cisplatin resistance. Biosci Rep. 2018 Aug 29;38(4):BSR20180547. doi: 10.1042/BSR20180547. Print 2018 Aug 31.
Ref 4 MicroRNA-212-3p inhibits paclitaxel resistance through regulating epithelial-mesenchymal transition, migration and invasion by targeting ZEB2 in human hepatocellular carcinoma. Oncol Lett. 2020 Oct 20(4):23
Ref 5 MicroRNA-216a/217-induced epithelial-mesenchymal transition targets PTEN and SMAD7 to promote drug resistance and recurrence of liver cancer. Hepatology. 2013 Aug;58(2):629-41. doi: 10.1002/hep.26369. Epub 2013 Jun 25.
Ref 6 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
Ref 7 miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9. doi: 10.1002/ijc.25260.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.