Molecule Information
General Information of the Molecule (ID: Mol01399)
Name |
hsa-mir-216a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 216a
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR216A
|
||||
Gene ID | |||||
Location |
chr2:55988950-55989059[-]
|
||||
Sequence |
GAUGGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUGUUCAUACAAUCCCUCA
CAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUAGCCCUCACGA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung small cell carcinoma | [1] | |||
Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | 16HBE cells | Lung | Homo sapiens (Human) | CVCL_0112 |
H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 | |
H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a. | |||
Disease Class: Ovarian cancer | [2] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell colony | Activation | hsa05200 | ||
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
OVCA433 cells | Ovary | Homo sapiens (Human) | CVCL_0475 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-216a increases cisplatin resistance in ovarian cancer cells via downregulating PTEN. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung small cell carcinoma | [1] | |||
Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | 16HBE cells | Lung | Homo sapiens (Human) | CVCL_0112 |
H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 | |
H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a. HOTTIP functioned as an oncogene in SCLC progression by binding miR216a and abrogating its tumor-suppressive function in this setting. HOTTIP also increased the expression of anti-apoptotic factor BCL-2, a target gene of miR216a, and jointly enhanced chemoresistance of SCLC by regulating BCL-2. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung small cell carcinoma | [1] | |||
Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
Resistant Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | 16HBE cells | Lung | Homo sapiens (Human) | CVCL_0112 |
H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 | |
H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [3] | |||
Resistant Disease | Liver cancer [ICD-11: 2C12.6] | |||
Resistant Drug | Sorafenib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
Cell proliferation | Activation | hsa05200 | ||
PI3K/AKT signaling pathway | Activation | hsa04151 | ||
TGF-beta signaling pathway | Activation | hsa04350 | ||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
HCCLM3 cells | Liver | Homo sapiens (Human) | CVCL_6832 | |
Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
BEL-7404 cells | Liver | Homo sapiens (Human) | CVCL_6568 | |
PLC/PRF/5 cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
SNU449 cells | Liver | Homo sapiens (Human) | CVCL_0454 | |
Skhep1 cells | Liver | Homo sapiens (Human) | CVCL_0525 | |
HLE cells | Liver | Homo sapiens (Human) | CVCL_1281 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Overexpression of miR-216a/217 activates the PI3k/Akt and TGF-beta pathways by targeting PTEN and SMAD7, contributing to hepatocarcinogenesis, sorafenib resistance and tumor recurrence in HCC. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.