Molecule Information
General Information of the Molecule (ID: Mol01399)
| Name |
hsa-mir-216a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 216a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR216A
|
||||
| Gene ID | |||||
| Location |
chr2:55988950-55989059[-]
|
||||
| Sequence |
GAUGGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUGUUCAUACAAUCCCUCA
CAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUAGCCCUCACGA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [2] | |||
| Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | 16HBE cells | Lung | Homo sapiens (Human) | CVCL_0112 |
| H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
| H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 | |
| H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [3] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell colony | Activation | hsa05200 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| OVCA433 cells | Ovary | Homo sapiens (Human) | CVCL_0475 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-216a increases cisplatin resistance in ovarian cancer cells via downregulating PTEN. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [2] | |||
| Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | 16HBE cells | Lung | Homo sapiens (Human) | CVCL_0112 |
| H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
| H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 | |
| H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a. HOTTIP functioned as an oncogene in SCLC progression by binding miR216a and abrogating its tumor-suppressive function in this setting. HOTTIP also increased the expression of anti-apoptotic factor BCL-2, a target gene of miR216a, and jointly enhanced chemoresistance of SCLC by regulating BCL-2. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [2] | |||
| Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Resistant Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | 16HBE cells | Lung | Homo sapiens (Human) | CVCL_0112 |
| H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
| H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 | |
| H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Long non-coding RNA HOTTIP promotes BCL-2 expression and induces chemoresistance in small cell lung cancer by sponging miR216a. | |||
| Drug Sensitive Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [4] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MKN45 cells | Liver | Homo sapiens (Human) | CVCL_0434 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| BGC823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Quantitative analyses revealed substantial downregulation of miR-216a-5p in both clinical GC samples and cellular models relative to matched non-neoplastic mucosal tissues and normal epithelial controls. Functional assays demonstrated that miR-216a-5p inhibited GC cell proliferation and migration while enhancing their sensitivity to OXA. Mechanistically, miR-216a-5p directly targeted and downregulated ZBTB2, thereby modulating GC cell growth and chemoresistance. Rescue experiments confirmed that ZBTB2 overexpression partially reversed the effects of miR-216a-5p on GC cells. In vivo studies further supported the tumour-suppressive role of miR-216a-5p and its regulation of ZBTB2. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Liver cancer [ICD-11: 2C12.6] | [5] | |||
| Resistant Disease | Liver cancer [ICD-11: 2C12.6] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
| Cell proliferation | Activation | hsa05200 | ||
| PI3K/AKT signaling pathway | Activation | hsa04151 | ||
| TGF-beta signaling pathway | Activation | hsa04350 | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| HCCLM3 cells | Liver | Homo sapiens (Human) | CVCL_6832 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| BEL-7404 cells | Liver | Homo sapiens (Human) | CVCL_6568 | |
| PLC/PRF/5 cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
| SNU449 cells | Liver | Homo sapiens (Human) | CVCL_0454 | |
| Skhep1 cells | Liver | Homo sapiens (Human) | CVCL_0525 | |
| HLE cells | Liver | Homo sapiens (Human) | CVCL_1281 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-216a/217 activates the PI3k/Akt and TGF-beta pathways by targeting PTEN and SMAD7, contributing to hepatocarcinogenesis, sorafenib resistance and tumor recurrence in HCC. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [6] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Verapamil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] | [7] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot | |||
| Experiment for Drug Resistance |
MTT assay; Apoptosis assay | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [7] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot | |||
| Experiment for Drug Resistance |
MTT assay; Apoptosis assay | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
