Molecule Information

General Information of the Molecule (ID: Mol01390)

• Name: hsa-mir-199b ,Homo sapiens
• Synonyms: microRNA 199b
• Molecule Type: Precursor miRNA
• Gene Name: MIR199B
• Gene ID: 406978
• Location: chr9:128244721-128244830[-]
• Sequence:
  CCAGAGGACACCUCCACUCCGUCUACCCAGUGUUUAGACUAUCUGUUCAGGACUCCCAAA
  UUGUACAGUAGUCUGCACAUUGGUUAGGCUGGGCUGGGUUAGACCCUCGG
• Ensembl ID: ENSG00000207581
• HGNC ID: HGNC:31573
• Precursor Accession: MI0000282

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Regulation; N.A.
• In Vitro Model: ALDHA1+ CCSCs cells; Colon; Homo sapiens (Human); N.A.
• In Vitro Model: ALDHA1 cells; Colon; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay; MTT assay
• Mechanism Description: Upregulation of miR199a/b contributes to cisplatin resistance via Wnt/beta-catenin-ABCG2 signaling pathway in ALDHA1+ colorectal cancer stem cells. Gsk3beta was the direct target of miR199a/b, miR199a/b regulates Wnt/beta-catenin pathway by targeting Gsk3beta in ALDHA1+ CCSCs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [3]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: RT-PCR was found to be a more sensitive technique to study miRNA expression in 9q deleted patients where deletions are missed out by FISH. The miRNA expression is important in the 9q deleted patients as miR-199b associated with drug resistance and can be used as a prognostic factor in 9q deleted CML patients.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [4]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: SIRT1/CREB/KISS1 signaling pathway; Regulation; N.A.
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vivo Model: Colorectal cancer patients; Nude mouse xenograft model; Homo sapiens
• Experiment for Molecule Alteration: MiRNA microarray analysis; RT-qPCR; Western blot; Luciferase reporter assay
• Experiment for Drug Resistance: Tumor cell invasion assay; Wound healing assay; Cell chemosensitivity assay
• Mechanism Description: Downregulation of miR-199b is associated with distant metastasis in colorectal cancer via activation of SIRT1 and inhibition of CREB/KISS1 signaling

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: Upregulation of miR-199a/b contributes to cisplatin resistance via Wnt/Beta-catenin-ABCG2 signaling pathway in ALDHA1(+) colorectal cancer stem cells. Tumour Biol. 2017 Jun;39(6):1010428317715155. doi: 10.1177/1010428317715155.
• Ref 2: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 3: Down-regulation of miR-199b associated with imatinib drug resistance in 9q34.1 deleted BCR/ABL positive CML patients. Gene. 2014 Jun 1;542(2):109-12. doi: 10.1016/j.gene.2014.03.049. Epub 2014 Mar 27.
• Ref 4: Intermittent High-Dose Scheduling of AZD8835, a Novel Selective Inhibitor of PI3KAlpha and PI3K Delta, Demonstrates Treatment Strategies for PIK3CA-Dependent Breast CancersMol Cancer Ther. 2016 May;15(5):877-89. doi: 10.1158/1535-7163.MCT-15-0687. Epub 2016 Feb 2.