Molecule Information

General Information of the Molecule (ID: Mol01390)

Name	hsa-mir-199b ,Homo sapiens
Synonyms	microRNA 199b Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR199B
Gene ID	406978
Location	chr9:128244721-128244830[-]
Sequence	CCAGAGGACACCUCCACUCCGUCUACCCAGUGUUUAGACUAUCUGUUCAGGACUCCCAAA UUGUACAGUAGUCUGCACAUUGGUUAGGCUGGGCUGGGUUAGACCCUCGG Click to Show/Hide
Ensembl ID	ENSG00000207581
HGNC ID	HGNC:31573
Precursor Accession	MI0000282
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Colorectal cancer				[1]
Resistant Disease	Colorectal cancer [ICD-11: 2B91.1]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Wnt/Beta-catenin signaling pathway		Regulation	hsa04310
In Vitro Model	ALDHA1+ CCSCs cells	Colon	Homo sapiens (Human)	N.A.
	ALDHA1 cells	Colon	Homo sapiens (Human)	N.A.
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Flow cytometry assay; MTT assay
Mechanism Description	Upregulation of miR199a/b contributes to cisplatin resistance via Wnt/beta-catenin-ABCG2 signaling pathway in ALDHA1+ colorectal cancer stem cells. Gsk3beta was the direct target of miR199a/b, miR199a/b regulates Wnt/beta-catenin pathway by targeting Gsk3beta in ALDHA1+ CCSCs.

Imatinib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Chronic myeloid leukemia			[2]
Resistant Disease	Chronic myeloid leukemia [ICD-11: 2A20.0]		Disease Info
Resistant Drug	Imatinib		Drug Info
Molecule Alteration	Expression	Down-regulation
Experimental Note	Identified from the Human Clinical Data
In Vivo Model	Nude mouse xenograft model		Mus musculus
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	RT-PCR was found to be a more sensitive technique to study miRNA expression in 9q deleted patients where deletions are missed out by FISH. The miRNA expression is important in the 9q deleted patients as miR-199b associated with drug resistance and can be used as a prognostic factor in 9q deleted CML patients.

References

Ref 1	Upregulation of miR-199a/b contributes to cisplatin resistance via Wnt/Beta-catenin-ABCG2 signaling pathway in ALDHA1(+) colorectal cancer stem cells. Tumour Biol. 2017 Jun;39(6):1010428317715155. doi: 10.1177/1010428317715155.
Ref 2	Down-regulation of miR-199b associated with imatinib drug resistance in 9q34.1 deleted BCR/ABL positive CML patients. Gene. 2014 Jun 1;542(2):109-12. doi: 10.1016/j.gene.2014.03.049. Epub 2014 Mar 27.