Molecule Information
General Information of the Molecule (ID: Mol01390)
| Name |
hsa-mir-199b
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 199b
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR199B
|
||||
| Gene ID | |||||
| Location |
chr9:128244721-128244830[-]
|
||||
| Sequence |
CCAGAGGACACCUCCACUCCGUCUACCCAGUGUUUAGACUAUCUGUUCAGGACUCCCAAA
UUGUACAGUAGUCUGCACAUUGGUUAGGCUGGGCUGGGUUAGACCCUCGG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [1] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Wnt/Beta-catenin signaling pathway | Regulation | N.A. | |
| In Vitro Model | ALDHA1+ CCSCs cells | Colon | Homo sapiens (Human) | N.A. |
| ALDHA1 cells | Colon | Homo sapiens (Human) | N.A. | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay; MTT assay | |||
| Mechanism Description | Upregulation of miR199a/b contributes to cisplatin resistance via Wnt/beta-catenin-ABCG2 signaling pathway in ALDHA1+ colorectal cancer stem cells. Gsk3beta was the direct target of miR199a/b, miR199a/b regulates Wnt/beta-catenin pathway by targeting Gsk3beta in ALDHA1+ CCSCs. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [2] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | RT-PCR was found to be a more sensitive technique to study miRNA expression in 9q deleted patients where deletions are missed out by FISH. The miRNA expression is important in the 9q deleted patients as miR-199b associated with drug resistance and can be used as a prognostic factor in 9q deleted CML patients. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
