General Information of the Molecule (ID: Mol01379)
Name
hsa-mir-10a ,Homo sapiens
Synonyms
microRNA 10a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR10A
Gene ID
406902
Location
chr17:48579838-48579947[-]
Sequence
GAUCUGUCUGUCUUCUGUAUAUACCCUGUAGAUCCGAAUUUGUGUAAGGAAUUUUGUGGU
CACAAAUUCGUAUCUAGGGGAAUAUGUAGUUGACAUAAACACUCCGCUCU
    Click to Show/Hide
Ensembl ID
ENSG00000284038
HGNC ID
HGNC:31497
Precursor Accession
MI0000266
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [1]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
TGF-beta/Smad2/STAT3/STAT5 signaling pathway Activation hsa04350
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
MTS assay; Flow cytometry assay
Mechanism Description miR-10a had an important role in promoting drug resistance in tumors through enhancing drug efflux and inhibiting apoptosis via upregulation of MDR1, MRP1 and RhoE expression. In addition, miR-10a promoted the expression of TGF-beta as wells as regulated the activity of the Smad2/STAT3/STAT5 pathway and its downstream transcriptional factors of HIF and eIF4E, which may be the potential mechanism of drug resistance in A549 cells. Therefore, miR-10a may be an important drug target for improving cancer treatment; however, further studies are required to explore the clinical applications of miR-10a inhibitors.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [2]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [3]
Resistant Disease Glioblastoma [ICD-11: 2A00.02]
Resistant Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model U87 cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Upregulation of TUSC7,which acted by directly targeting and silencing expression of miR-10a gene, suppressed both TMZ resistance and expression of multidrug resistance protein 1 (MDR1) in U87TR cells,, and miR-10a mediated TUSC7-induced inhibition on TMZ resistance in U87TR cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [4]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
TGF-beta signaling pathway Regulation N.A.
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description LncRNA RP11-838N2.4 (+) TMZ sensitivity in GBM by serving as a ceRNA, sequestering with miR-10a on an epigenetic level.
References
Ref 1 MicroRNA-10a silencing reverses cisplatin resistance in the A549/cisplatin human lung cancer cell line via the transforming growth factor-Beta/Smad2/STAT3/STAT5 pathway. Mol Med Rep. 2015 May;11(5):3854-9. doi: 10.3892/mmr.2015.3181. Epub 2015 Jan 12.
Ref 2 miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
Ref 3 Long non-coding RNA TUSC7 inhibits temozolomide resistance by targeting miR-10a in glioblastoma. Cancer Chemother Pharmacol. 2018 Apr;81(4):671-678. doi: 10.1007/s00280-018-3522-y. Epub 2018 Feb 3.
Ref 4 Long noncoding RNA RP11-838N2.4 enhances the cytotoxic effects of temozolomide by inhibiting the functions of miR-10a in glioblastoma cell lines. Oncotarget. 2016 Jul 12;7(28):43835-43851. doi: 10.18632/oncotarget.9699.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.