Molecule Information

General Information of the Molecule (ID: Mol01370)

• Name: hsa-mir-197 ,Homo sapiens
• Synonyms: microRNA 197
• Molecule Type: Precursor miRNA
• Gene Name: MIR197
• Gene ID: 406974
• Location: chr1:109598893-109598967[+]
• Sequence:
  GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCU
  CCACCCAGCAUGGCC
• Ensembl ID: ENSG00000284443
• HGNC ID: HGNC:31569
• Precursor Accession: MI0000239

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 10 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: Wnt signaling pathway; Inhibition; hsa04310
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT549 cells; Breast; Homo sapiens (Human); CVCL_1092
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: LncRNA TUG1 sensitized triple negative breast cancer to cisplatin by upregulating NLk expression via sponging miR-197.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] [2]

• Resistant Disease: Head and neck squamous cell carcinoma [ICD-11: 2D42.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cytotoxic Assay
• Mechanism Description: MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] [2]

• Resistant Disease: Head and neck squamous cell carcinoma [ICD-11: 2D42.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cytotoxic Assay
• Mechanism Description: MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs.

Erlotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [3]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Erlotinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Role of stromal cells in rheumatoid arthritis; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: High-throughput miRNA analysis
• Experiment for Drug Resistance: Sulforhodamine-B assay
• Mechanism Description: Expression of 13 miRNA genes predicts response to EGFR inhibition in cancer cell lines and tumours, and discriminates primary from metastatic tumours. Signature genes target proteins that are enriched for epithelial-to-mesenchymal transition (EMT) genes. Epithelial-to-mesenchymal transition predicts EGFR inhibitor resistance and metastatic behaviour. The EMT transcription factor, ZEB1, shows altered expression in erlotinib-sensitive NSCLC and PDAC, where many signature miRNA genes are upregulated. Ectopic expression of mir-200c alters expression of EMT proteins, sensitivity to erlotinib, and migration in lung cells. Treatment with TGFbeta1 changes expression of signature miRNA and EMT proteins and modulates migration in lung cells.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MRP-1/ABCC1; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR; Luciferase reporter assay; Western blot; Immunofluorescence staining
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Seventeen of miRNAs were differentially expressed in MCF-7/VP cells and their parent cells. The majority of these miRNAs exhibited increased expression levels, while miR-326, miR-429, miR-187, miR-7, and miR-92-2 showed decreased expression.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [5]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signaling pathway; Inhibition; hsa04010
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: When miR-197 was overexpressed in SGC7901 cells, the protein levels of MAPk1 were downregulated. Furthermore, MAPk1 knockdown significantly increased the growth inhibition rate of the SGC7901/5-FU cells compared with those in the control group. These results indicated that miR-197 may influence the sensitivity of 5-FU treatment in a gastric cancer cell line by targeting MAPk1.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] [2]

• Resistant Disease: Head and neck squamous cell carcinoma [ICD-11: 2D42.0]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cytotoxic Assay
• Mechanism Description: MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] [2]

• Resistant Disease: Head and neck squamous cell carcinoma [ICD-11: 2D42.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cytotoxic Assay
• Mechanism Description: MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [6]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

References

• Ref 1: Long non-coding RNA TUG1 sponges miR-197 to enhance cisplatin sensitivity in triple negative breast cancer. Biomed Pharmacother. 2018 Nov;107:338-346. doi: 10.1016/j.biopha.2018.07.076. Epub 2018 Aug 8.
• Ref 2: miR-135a contributes to paclitaxel resistance in tumor cells both in vitro and in vivo. Oncogene. 2011 Oct 27;30(43):4386-98. doi: 10.1038/onc.2011.148. Epub 2011 May 9.
• Ref 3: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 4: Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. doi: 10.1016/j.bcp.2009.10.017. Epub 2009 Oct 31.
• Ref 5: MicroRNA 197 reverses the drug resistance of fluorouracil induced SGC7901 cells by targeting mitogen activated protein kinase 1. Mol Med Rep. 2015 Oct;12(4):5019-25. doi: 10.3892/mmr.2015.4052. Epub 2015 Jul 7.
• Ref 6: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.