Molecule Information
General Information of the Molecule (ID: Mol01370)
Name |
hsa-mir-197
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 197
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR197
|
||||
Gene ID | |||||
Location |
chr1:109598893-109598967[+]
|
||||
Sequence |
GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCU
CCACCCAGCAUGGCC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
Wnt signaling pathway | Inhibition | hsa04310 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | LncRNA TUG1 sensitized triple negative breast cancer to cisplatin by upregulating NLk expression via sponging miR-197. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | MAPK signaling pathway | Inhibition | hsa04010 | |
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | When miR-197 was overexpressed in SGC7901 cells, the protein levels of MAPk1 were downregulated. Furthermore, MAPk1 knockdown significantly increased the growth inhibition rate of the SGC7901/5-FU cells compared with those in the control group. These results indicated that miR-197 may influence the sensitivity of 5-FU treatment in a gastric cancer cell line by targeting MAPk1. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.