Molecule Information

General Information of the Molecule (ID: Mol01370)

• Name: hsa-mir-197 ,Homo sapiens
• Synonyms: microRNA 197
• Molecule Type: Precursor miRNA
• Gene Name: MIR197
• Gene ID: 406974
• Location: chr1:109598893-109598967[+]
• Sequence:
  GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCU
  CCACCCAGCAUGGCC
• Ensembl ID: ENSG00000284443
• HGNC ID: HGNC:31569
• Precursor Accession: MI0000239

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: Wnt signaling pathway; Inhibition; hsa04310
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT549 cells; Breast; Homo sapiens (Human); CVCL_1092
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: LncRNA TUG1 sensitized triple negative breast cancer to cisplatin by upregulating NLk expression via sponging miR-197.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signaling pathway; Inhibition; hsa04010
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: When miR-197 was overexpressed in SGC7901 cells, the protein levels of MAPk1 were downregulated. Furthermore, MAPk1 knockdown significantly increased the growth inhibition rate of the SGC7901/5-FU cells compared with those in the control group. These results indicated that miR-197 may influence the sensitivity of 5-FU treatment in a gastric cancer cell line by targeting MAPk1.

References

• Ref 1: Long non-coding RNA TUG1 sponges miR-197 to enhance cisplatin sensitivity in triple negative breast cancer. Biomed Pharmacother. 2018 Nov;107:338-346. doi: 10.1016/j.biopha.2018.07.076. Epub 2018 Aug 8.
• Ref 2: MicroRNA 197 reverses the drug resistance of fluorouracil induced SGC7901 cells by targeting mitogen activated protein kinase 1. Mol Med Rep. 2015 Oct;12(4):5019-25. doi: 10.3892/mmr.2015.4052. Epub 2015 Jul 7.