General Information of the Molecule (ID: Mol01363)
Name
hsa-mir-29b ,Homo sapiens
Synonyms
microRNA 29b-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR29B1
Gene ID
407024
Location
chr7:130877459-130877539[-]
Sequence
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUU
UGAAAUCAGUGUUCUUGGGGG
    Click to Show/Hide
Ensembl ID
ENSG00000283797
HGNC ID
HGNC:31619
Precursor Accession
MI0000105
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
CP70 cells Ovary Homo sapiens (Human) CVCL_0135
HeyC2 cells Ovary Homo sapiens (Human) CVCL_X009
In Vivo Model NOD/SCID nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Knockdown of miR-29a/b/c increased the ability of cells to escape cisplatin-induced cell death partly through upregulation of collagen type I alpha 1 (COL1A1) and increased the activation of extracellular signal-regulated kinase 1/2 and inactivation of glycogen synthase kinase 3 beta.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description The expression of miR-29b was significantly upregualted by cisplatin treatment,while its target gene AkT2 was downregulated. The up-regulation of miR-29b (+) the sensitivity of gastric cancer cells to cisplatin,while the knock-down of miR-29b (+) the cisplatin resistance. Rescue experiments demonstrated that the miR-29b might regulate cisplatin resistance of gastric cancer cell by targeting PI3k/Akt pathway. The expressions of the other two members of miR-29 family, miR-29a/c, were promoted by cisplatin treatment,but they had no significant effect on gastric cancer cell's resistance to cisplatin.
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [3]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model 3AB-OS CSC cells Bone marrow Homo sapiens (Human) CVCL_LM95
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Trypan blue assay; Flow cytometry assay
Mechanism Description miR-29b-1 overexpression sensitized 3AB-OS cells to chemotherapeutic drug-induced apoptosis miR-29b-1 negatively regulated the expression of Bcl-2.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR29b signaling pathway Regulation N.A.
In Vitro Model OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
H&E staining assay
Mechanism Description The ATG9A down expression due to miR-29b increasing could significantly promote Ovarian carcinoma drug sensitivity on different chemotherapeutic drugs (Cisplatin, Paclitaxel, Platinum, Cyclophosphamide).
Cyclophosphamide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cyclophosphamide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR29b signaling pathway Regulation N.A.
In Vitro Model OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
H&E staining assay
Mechanism Description The ATG9A down expression due to miR-29b increasing could significantly promote Ovarian carcinoma drug sensitivity on different chemotherapeutic drugs (Cisplatin, Paclitaxel, Platinum, Cyclophosphamide).
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Negroid cervix epitheloid carcinoma [ICD-11: 2E66.Y] [5]
Sensitive Disease Negroid cervix epitheloid carcinoma [ICD-11: 2E66.Y]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
xCELLigence cell viability assay; Flow cytometry assay; Caspase-3 activity assay
Mechanism Description microRNA hsa-miR29b potentiates etoposide toxicity in HeLa cells via down-regulation of Mcl-1.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cholangiocarcinoma [ICD-11: 2C12.0] [6]
Sensitive Disease Cholangiocarcinoma [ICD-11: 2C12.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HuCCT1 cells Bile duct Homo sapiens (Human) CVCL_0324
HuH28 cells Bile duct Homo sapiens (Human) CVCL_2955
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Two miR-29b target genes, PIk3R1 and MMP-2, that are, at least partly, responsible for the resistance of CCA Gem treatment. PIk3R1 encodes phosphoinositide 3-kinase (PI3k) regulatory subunit designated p85 alpha; p85 alpha is regarded as integrator of multiple signaling pathways that together promote cell proliferation, cell survival, and carcinogenesis.
Methotrexate
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [7]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Methotrexate
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Overexpression of miR-29b suppressed MTX resistance and promoted cell apoptosis by downregulating MCL1 expression.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR29b signaling pathway Regulation N.A.
In Vitro Model OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
H&E staining assay
Mechanism Description The ATG9A down expression due to miR-29b increasing could significantly promote Ovarian carcinoma drug sensitivity on different chemotherapeutic drugs (Cisplatin, Paclitaxel, Platinum, Cyclophosphamide).
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Platinum
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Platinum
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR29b signaling pathway Regulation N.A.
In Vitro Model OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
H&E staining assay
Mechanism Description The ATG9A down expression due to miR-29b increasing could significantly promote Ovarian carcinoma drug sensitivity on different chemotherapeutic drugs (Cisplatin, Paclitaxel, Platinum, Cyclophosphamide).
References
Ref 1 Downregulation of miR-29 contributes to cisplatin resistance of ovarian cancer cells. Int J Cancer. 2014 Feb 1;134(3):542-51. doi: 10.1002/ijc.28399. Epub 2013 Aug 28.
Ref 2 [miR-29b Reduces Cisplatin Resistance of Gastric Cancer Cell by Targeting PI3K/Akt Pathway]. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 2015 Oct;37(5):514-9. doi: 10.3881/j.issn.1000-503X.2015.05.005.
Ref 3 MicroRNA-29b-1 impairs in vitro cell proliferation, self renewal and chemoresistance of human osteosarcoma 3AB-OS cancer stem cells. Int J Oncol. 2014 Nov;45(5):2013-23. doi: 10.3892/ijo.2014.2618. Epub 2014 Aug 22.
Ref 4 Involvement of miR-29b signaling in the sensitivity to chemotherapy in patients with ovarian carcinoma. Hum Pathol. 2014 Jun;45(6):1285-93. doi: 10.1016/j.humpath.2014.02.008. Epub 2014 Feb 28.
Ref 5 MicroRNA hsa-miR-29b potentiates etoposide toxicity in HeLa cells via down-regulation of Mcl-1. Toxicol In Vitro. 2017 Apr;40:289-296. doi: 10.1016/j.tiv.2017.02.005. Epub 2017 Feb 6.
Ref 6 miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623. doi: 10.1371/journal.pone.0077623. eCollection 2013.
Ref 7 miR-29 Family Inhibits Resistance to Methotrexate and Promotes Cell Apoptosis by Targeting COL3A1 and MCL1 in Osteosarcoma. Med Sci Monit. 2018 Dec 6;24:8812-8821. doi: 10.12659/MSM.911972.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.