Molecule Information

General Information of the Molecule (ID: Mol01358)

• Name: hsa-mir-96 ,Homo sapiens
• Synonyms: microRNA 96
• Molecule Type: Precursor miRNA
• Gene Name: MIR96
• Gene ID: 407053
• Location: chr7:129774692-129774769[-]
• Sequence:
  UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAAUCAUGUG
  CAGUGCCAAUAUGGGAAA
• Ensembl ID: ENSG00000199158
• HGNC ID: HGNC:31648
• Precursor Accession: MI0000098

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal cancer [1]

• Sensitive Disease: Esophageal cancer [ICD-11: 2B70.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: TE-1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• In Vitro Model: EC9706 cells; Esophagus; Homo sapiens (Human); CVCL_E307
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; CCK8 assay
• Mechanism Description: Ectopic overexpression of miR-96 in TE-1 or ECa-109 contributed to tumor growth in xenograft mouse models. Furthermore, up-regulation of miR-96 could reduce the susceptibilities of EC cells to chemotherapy or radiotherapy. RECk was identified as a target of miR-96 and RECk overexpressing could abrogate the growth of EC cells induced by miR-96. Taken together, miR-96 serves as an oncogene role in EC cells through downregulating RECk.

Disease Class: Osteosarcoma [2]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage.

Disease Class: Breast ductal carcinoma [2]

• Sensitive Disease: Breast ductal carcinoma [ICD-11: 2C61.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage.

Disease Class: Breast adenocarcinoma [2]

• Sensitive Disease: Breast adenocarcinoma [ICD-11: 2C60.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage.

Disease Class: Cervical cancer [2]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage.

References

• Ref 1: MiR-96 promotes proliferation and chemo- or radioresistance by down-regulating RECK in esophageal cancer. Biomed Pharmacother. 2014 Oct;68(8):951-8. doi: 10.1016/j.biopha.2014.10.023. Epub 2014 Oct 31.
• Ref 2: MiR-96 downregulates REV1 and RAD51 to promote cellular sensitivity to cisplatin and PARP inhibition. Cancer Res. 2012 Aug 15;72(16):4037-46. doi: 10.1158/0008-5472.CAN-12-0103. Epub 2012 Jul 3.