Molecule Information

General Information of the Molecule (ID: Mol01358)
Name
hsa-mir-96 ,Homo sapiens
Synonyms
microRNA 96
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR96
Gene ID
407053
Location
chr7:129774692-129774769[-]
Sequence
UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAAUCAUGUG
CAGUGCCAAUAUGGGAAA
    Click to Show/Hide
Ensembl ID
ENSG00000199158
HGNC ID
HGNC:31648
Precursor Accession
MI0000098
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
Experiment for
Molecule Alteration		 MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
Experiment for
Drug Resistance		 Cell proliferation assay; Flow cytometry
Mechanism Description We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [2]
Sensitive Disease Esophageal cancer [ICD-11: 2B70.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model ECA-109 cells Esophagus Homo sapiens (Human) CVCL_6898
TE-1 cells Esophagus Homo sapiens (Human) CVCL_1759
EC9706 cells Esophagus Homo sapiens (Human) CVCL_E307
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; CCK8 assay
Mechanism Description Ectopic overexpression of miR-96 in TE-1 or ECa-109 contributed to tumor growth in xenograft mouse models. Furthermore, up-regulation of miR-96 could reduce the susceptibilities of EC cells to chemotherapy or radiotherapy. RECk was identified as a target of miR-96 and RECk overexpressing could abrogate the growth of EC cells induced by miR-96. Taken together, miR-96 serves as an oncogene role in EC cells through downregulating RECk.
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [3]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage.
Disease Class: Breast ductal carcinoma [ICD-11: 2C61.0] [3]
Sensitive Disease Breast ductal carcinoma [ICD-11: 2C61.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC1937 cells Breast Homo sapiens (Human) CVCL_0290
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage.
Disease Class: Breast adenocarcinoma [ICD-11: 2C60.1] [3]
Sensitive Disease Breast adenocarcinoma [ICD-11: 2C60.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [3]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [4]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model PC3 cells Prostate Homo sapiens (Human) CVCL_0035
DU145 cells Prostate Homo sapiens (Human) CVCL_0105
Experiment for
Molecule Alteration		 qPCR
Mechanism Description Global microRNA profiling was performed on docetaxel-resistant and sensitive cell lines to identify candidate circulating microRNA biomarkers. Custom Taqman Array MicroRNA cards were used to measure the levels of 46 candidate microRNAs in plasma/serum samples, collected before and after docetaxel treatment, from 97 CRPC patients. Expression of hsa-mir-96 is decreased.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [5]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
Experiment for
Drug Resistance		 CellTiter-Blue Cell Viability Assay (Promega)
Mechanism Description Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [6]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Resistant Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Caspase-3 activity assay
Mechanism Description Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.
Olaparib
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant glioma [ICD-11: 2A00.02] [7]
Sensitive Disease Malignant glioma [ICD-11: 2A00.02]
 Disease Info 
Sensitive Drug Olaparib
 Drug Info 
Molecule Alteration Expression
Overexpression
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
HCC1937 cells Breast Homo sapiens (Human) CVCL_0290
In Vivo Model 6-7 week old female NOD SCID mice Mus musculus
Experiment for
Molecule Alteration		 Immunofluorescence microscopy; Western blot; RT-PCR
Experiment for
Drug Resistance		 Cell cycle analysis; Crystal violet assay; Clonogenic survival assay
Mechanism Description Overexpression of miR-96 decreased the efficiency of homologous recombination and enhanced sensitivity to the PARP inhibitor AZD2281 in vitro and to cisplatin both in vitro and in vivo. Taken together, our findings indicate that miR-96 regulates DNA repair and chemosensitivity by repressing RAD51 and REV1.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [8]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
LCC9 cells Breast Homo sapiens (Human) CVCL_DP52
Experiment for
Molecule Alteration		 Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [9]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [10]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
A549 cells Lung Homo sapiens (Human) CVCL_0023
A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
Experiment for
Drug Resistance		 MTT assay; Apoptosis assay
Disease Class: Gastric cancer [ICD-11: 2B72.0] [10]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
A549 cells Lung Homo sapiens (Human) CVCL_0023
A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
Experiment for
Drug Resistance		 MTT assay; Apoptosis assay
References
Ref 1 Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
Ref 2 MiR-96 promotes proliferation and chemo- or radioresistance by down-regulating RECK in esophageal cancer. Biomed Pharmacother. 2014 Oct;68(8):951-8. doi: 10.1016/j.biopha.2014.10.023. Epub 2014 Oct 31.
Ref 3 MiR-96 downregulates REV1 and RAD51 to promote cellular sensitivity to cisplatin and PARP inhibition. Cancer Res. 2012 Aug 15;72(16):4037-46. doi: 10.1158/0008-5472.CAN-12-0103. Epub 2012 Jul 3.
Ref 4 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 5 Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
Ref 6 MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
Ref 7 Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 8 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
Ref 9 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
Ref 10 miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9. doi: 10.1002/ijc.25260.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.