Molecule Information
General Information of the Molecule (ID: Mol01358)
| Name |
hsa-mir-96
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 96
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR96
|
||||
| Gene ID | |||||
| Location |
chr7:129774692-129774769[-]
|
||||
| Sequence |
UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAAUCAUGUG
CAGUGCCAAUAUGGGAAA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal cancer [ICD-11: 2B70.1] | [1] | |||
| Sensitive Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | ECA-109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 |
| TE-1 cells | Esophagus | Homo sapiens (Human) | CVCL_1759 | |
| EC9706 cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; CCK8 assay | |||
| Mechanism Description | Ectopic overexpression of miR-96 in TE-1 or ECa-109 contributed to tumor growth in xenograft mouse models. Furthermore, up-regulation of miR-96 could reduce the susceptibilities of EC cells to chemotherapy or radiotherapy. RECk was identified as a target of miR-96 and RECk overexpressing could abrogate the growth of EC cells induced by miR-96. Taken together, miR-96 serves as an oncogene role in EC cells through downregulating RECk. | |||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage. | |||
| Disease Class: Breast ductal carcinoma [ICD-11: 2C61.0] | [2] | |||
| Sensitive Disease | Breast ductal carcinoma [ICD-11: 2C61.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage. | |||
| Disease Class: Breast adenocarcinoma [ICD-11: 2C60.1] | [2] | |||
| Sensitive Disease | Breast adenocarcinoma [ICD-11: 2C60.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage. | |||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [2] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
