Molecule Information

General Information of the Molecule (ID: Mol01357)

• Name: hsa-mir-93 ,Homo sapiens
• Synonyms: microRNA 93
• Molecule Type: Precursor miRNA
• Gene Name: MIR93
• Gene ID: 407050
• Location: chr7:100093768-100093847[-]
• Sequence:
  CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUAGUGUGAUUACCCAACCUACUGCUGAGCU
  AGCACUUCCCGAGCCCCCGG
• Ensembl ID: ENSG00000207757
• HGNC ID: HGNC:31645
• Precursor Accession: MI0000095

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 9 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal carcinoma [ICD-11: 2C23.0] [1]

• Resistant Disease: Laryngeal carcinoma [ICD-11: 2C23.0]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• Experiment for Molecule Alteration: RT-PCR, microarray analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: A total of 7 differentially expressed miRNAs were identified when Hep-2 and Hep-2/v cells were compared by microarray analysis. Two miRNAs (has-miR-210 and has-miR-923) were significantly up-regulated and five miRNAs (has-miR-93, has-miR-93-star, has-miR-424-star, has-miR-25-star, and has-miR-494) were significantly down-regulated in Hep-2/v cells.

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] [2]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: C4-2 cells; Prostate; Homo sapiens (Human); CVCL_4782
• In Vitro Model: KHM-5M cells; Pleural effusion; Homo sapiens (Human); CVCL_2975
• Experiment for Drug Resistance: Clinical diagnostic evaluation
• Mechanism Description: Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.

Cabergoline

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] [2]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Cabergoline
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: C4-2 cells; Prostate; Homo sapiens (Human); CVCL_4782
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: CCK-8 assay
• Mechanism Description: Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Activation; hsa05235
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-93, a new family member of PTEN regulator, blocks PTEN translation leading to activation of the AkT pathway and played an important role in regulating cisplatin chemosensitivity pathway in ovarian cancer.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: There is an elevated expression of DNA polymerase Eta (Pol Eta) in ovarian CSCs isolated from both ovarian cancer cell lines and primary tumors, indicating that CSCs may have intrinsically (+) translesion DNA synthesis (TLS). Down-regulation of Pol Eta blocked cisplatin-induced CSC enrichment both in vitro and in vivo through the enhancement of cisplatin-induced apoptosis in CSCs, indicating that Pol Eta-mediated TLS contributes to the survival of CSCs upon cisplatin treatment. Furthermore, our data demonstrated a depletion of miR-93 in ovarian CSCs. Enforced expression of miR-93 in ovarian CSCs reduced Pol Eta expression and increased their sensitivity to cisplatin. Taken together, our data suggest that ovarian CSCs have intrinsically (+) Pol Eta-mediated TLS, allowing CSCs to survive cisplatin treatment, leading to tumor relapse. Targeting Pol Eta, probably through enhancement of miR-93 expression, might be exploited as a strategy to increase the efficacy of cisplatin treatment.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [ICD-11: 2C60.3] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell motility; Activation; hsa04510
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Self-renewal signaling pathway; Activation; hsa04550
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR93 contributes to inducing EMT and drug resistance of breast cancer cells by targeting PTEN.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [6]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: TGF-betasignalling pathway; Regulation; N.A.
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Flow cytometry
• Mechanism Description: The aim of this study was to analyze the effect of chemotherapy for mCRC on TGF-beta signaling and related miRNAs. Hsa-miR-17-5p, hsa-miR-21-5p and hsa-miR-93-5p were selected out of 316 miRNAs with multiple targets within the TGF-beta signaling by in silico analysis. SW620 cells were treated with chemotherapeutic drugs for mCRC for 1, 3 and 6 days and expression of selected miRNAs, PAI-1, CDH1 and VIM was measured. Expression of TGF-beta signaling-related hsa-miR-17-5p, hsa-miR-21-5p and hsa-miR-93-5p was time-dependently altered in SW620 cells treated with chemotherapeutics for mCRC. The expression of hsa-miR-93-5p remained downregulated after 6 days under combined treatments FOX and FIRI as well as the hsa-miR-17-5p expression under FIRI. Chemotherapy regimens for mCRC increased expression of a major TGF-beta signaling target gene PAI-1, independently of the selected miRNAs expression. These treatments also increased the expression of epithelial-mesenchymal transition (EMT) markers CDH1 and VIM on day 3 resulting in decrease of mesenchymal-like characteristics. However, their expression returned close to basal level on day 6. In conclusion, after initial response to chemotherapeutic drugs SW620 cells start to return close to the basal mesenchymal state while the long-term downregulated expression pattern of hsa-miR-93-5p and hsa-miR-17-5p makes them candidates worth testing as biomarkers for monitoring combined chemotherapeutic treatments therapy response in mCRC patients.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.2]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: BCap37 cells; Breast; Homo sapiens (Human); CVCL_0164
• In Vitro Model: Bads-200 cells; Breast; Homo sapiens (Human); N.A.
• In Vivo Model: Immune-deficient nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Immunohistochemistry; qRT-PCR; Dual-luciferase reporter assay; Western blot
• Experiment for Drug Resistance: MTT assay; Flow cytometry analysis; Colony formation assay
• Mechanism Description: In this study, we found that miR-93-5p (miR-93) significantly inhibited cell proliferation, induced G1/S cell cycle arrest and increased chemosensitivity to paclitaxel (PTX) in vitro and in vivo

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [7]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal carcinoma [ICD-11: 2C23.0] [1]

• Resistant Disease: Laryngeal carcinoma [ICD-11: 2C23.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• Experiment for Molecule Alteration: RT-PCR, microarray analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: A total of 7 differentially expressed miRNAs were identified when Hep-2 and Hep-2/v cells were compared by microarray analysis. Two miRNAs (has-miR-210 and has-miR-923) were significantly up-regulated and five miRNAs (has-miR-93, has-miR-93-star, has-miR-424-star, has-miR-25-star, and has-miR-494) were significantly down-regulated in Hep-2/v cells.

References

• Ref 1: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 2: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 3: Involvement of microRNA-93, a new regulator of PTEN/Akt signaling pathway, in regulation of chemotherapeutic drug cisplatin chemosensitivity in ovarian cancer cells. FEBS Lett. 2012 May 7;586(9):1279-86. doi: 10.1016/j.febslet.2012.03.006. Epub 2012 Mar 27.
• Ref 4: Enhanced expression of DNA polymerase eta contributes to cisplatin resistance of ovarian cancer stem cells. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4411-6. doi: 10.1073/pnas.1421365112. Epub 2015 Mar 23.
• Ref 5: miR-93 and PTEN: Key regulators of doxorubicin-resistance and EMT in breast cancer. Oncol Rep. 2017 Oct;38(4):2401-2407. doi: 10.3892/or.2017.5859. Epub 2017 Jul 31.
• Ref 6: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 7: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.