General Information of the Molecule (ID: Mol01357)
Name
hsa-mir-93 ,Homo sapiens
Synonyms
microRNA 93
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR93
Gene ID
407050
Location
chr7:100093768-100093847[-]
Sequence
CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUAGUGUGAUUACCCAACCUACUGCUGAGCU
AGCACUUCCCGAGCCCCCGG
    Click to Show/Hide
Ensembl ID
ENSG00000207757
HGNC ID
HGNC:31645
Precursor Accession
MI0000095
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bromocriptine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
Resistant Drug Bromocriptine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model C4-2 cells Prostate Homo sapiens (Human) CVCL_4782
KHM-5M cells Pleural effusion Homo sapiens (Human) CVCL_2975
Experiment for
Drug Resistance
Clinical diagnostic evaluation
Mechanism Description Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.
Cabergoline
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
Resistant Drug Cabergoline
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model C4-2 cells Prostate Homo sapiens (Human) CVCL_4782
Experiment for
Molecule Alteration
Solexa sequencing assay; qRT-PCR
Experiment for
Drug Resistance
CCK-8 assay
Mechanism Description Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation PTEN/AKT signaling pathway Activation hsa05235
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-93, a new family member of PTEN regulator, blocks PTEN translation leading to activation of the AkT pathway and played an important role in regulating cisplatin chemosensitivity pathway in ovarian cancer.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OV2008 cells Ovary Homo sapiens (Human) CVCL_0473
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description There is an elevated expression of DNA polymerase Eta (Pol Eta) in ovarian CSCs isolated from both ovarian cancer cell lines and primary tumors, indicating that CSCs may have intrinsically (+) translesion DNA synthesis (TLS). Down-regulation of Pol Eta blocked cisplatin-induced CSC enrichment both in vitro and in vivo through the enhancement of cisplatin-induced apoptosis in CSCs, indicating that Pol Eta-mediated TLS contributes to the survival of CSCs upon cisplatin treatment. Furthermore, our data demonstrated a depletion of miR-93 in ovarian CSCs. Enforced expression of miR-93 in ovarian CSCs reduced Pol Eta expression and increased their sensitivity to cisplatin. Taken together, our data suggest that ovarian CSCs have intrinsically (+) Pol Eta-mediated TLS, allowing CSCs to survive cisplatin treatment, leading to tumor relapse. Targeting Pol Eta, probably through enhancement of miR-93 expression, might be exploited as a strategy to increase the efficacy of cisplatin treatment.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [4]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell motility Activation hsa04510
Cell proliferation Activation hsa05200
Self-renewal signaling pathway Activation hsa04550
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7/ADR cells Breast Homo sapiens (Human) CVCL_1452
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis
Mechanism Description miR93 contributes to inducing EMT and drug resistance of breast cancer cells by targeting PTEN.
References
Ref 1 MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
Ref 2 Involvement of microRNA-93, a new regulator of PTEN/Akt signaling pathway, in regulation of chemotherapeutic drug cisplatin chemosensitivity in ovarian cancer cells. FEBS Lett. 2012 May 7;586(9):1279-86. doi: 10.1016/j.febslet.2012.03.006. Epub 2012 Mar 27.
Ref 3 Enhanced expression of DNA polymerase eta contributes to cisplatin resistance of ovarian cancer stem cells. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4411-6. doi: 10.1073/pnas.1421365112. Epub 2015 Mar 23.
Ref 4 miR-93 and PTEN: Key regulators of doxorubicin-resistance and EMT in breast cancer. Oncol Rep. 2017 Oct;38(4):2401-2407. doi: 10.3892/or.2017.5859. Epub 2017 Jul 31.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.